TABLE 1

Primers used in plasmid construction

PrimerSequence (5′ to 3′)Description
1GGAATTCCATATGGAATTCCATGCTCCCCTCCATCGAGCNdeI site, CAP59 nt 1–19 sense (underlined)
2GAAAAGTTCTTCTCCTTTACTCATCGGTGGTTGAACAGACCTGFP nt 24–1 antisense (underlined), CAP59 nt 520–502 antisense
3GGAGATCTGCCGGTGGTTGAACAGACCTCBglII site, CAP59 nt 520–500 antisense (underlined)
4GAAGATCTTCATGCTCCCCTCCATCGAGBglII site, CAP59 nt 1–20 sense (underlined)
5AGGTCTGTTCAACCACCGATGAGTAAAGGAGAAGAACTTTTCThe antiparallel sequence of primer 2
6GGAGATCTCATAACAGAAAGTAGTGACAABglII site, GFP nt 230–250 antisense (underlined)
7CCATCGATGGCTGCGAGGATGTGCla site, actin promoter nt 1–14 sense (underlined)
8GGAATTCCATATGGTTGGGCGAGNdeI site, actin promoter nt 834–825 antisense (underlined)
1*GGAATTCCATATGGAATTCCATGGCCCCCAGAAAGACTGNdeI site, ADE2 nt 1–19 sense (underlined)
2*GTTCTTCTCCTTTACTCATTGCGGATTTAAGAGGAGAGGFP nt 24–1 antisense (underlined), ADE2 nt 520–502 antisense
3*GAAGATCTTCATGCGGATTTAAGAGGAGAGBglII site, ADE2 nt 521–502 antisense (underlined)
4*GAAGATCTTCATGGCCCCCAGAAAGACTGBglII site, ADE2 nt 1–19 sense (underlined)
5*CTCTCCTCTTAAATCCGCAATGAGTAAAGGAGAAGAACThe antiparallel sequence of primer 2*
6*GAAGATCTTCTGCGGATTTAAGAGGAGAGTTBglII site, GFP nt 250–230 antisense (underlined)
  • Restriction sites are in boldface type and sequences homologous to genes of interest are designated by the nucleotide (nt) position in the corresponding cDNA coding sequence (1 being the A of the initiating ATG) and whether they correspond to the sense or antisense strand. For the ACT promotor the nt numbers correspond to those in GenBank entry AF156670. Primers specific to pADE2i are designated with an asterisk (see materials and methods).