TABLE 2

Oligonucleotides

OligonucleotideGeneUseaSequencebRestriction site
SST2-USST2Upstream primersAGAGTTGTACCATGGTGGNcoI
SST2-HCTGAGGCGTTAAAGCTTCAATTTGHrndIII
SST2-1CTACGTTTCCATGGCAGGTATTAGNcoI
SST2-2TTCTCAAGCCATGGTTATCTCTTCNcoI
SST2-7CCAACACCCATGGGAGTTGCTGNcoI
SST2-3Downstream primersGAGTAAGACTCTGGATCCAATTAGCBamHI
SST2-4TAATACCTGGATCCGAAACGBamHI
SST2-5CCTTCACTAGGATCCAATGBamHI
SST2-8GGTTGTAAAGGATCCGGTACAATCBamHI
P20L-1Mutagenic primersCAGCAGAACGCTGAATGGACTGATCTTTAC
P20L-2GTAAAGATCAGTCCATTCAGCGTTCTGCTG
PCR3′-1Downstream primerCAGAATTTACGTATCTAAACAC
G302ser-KS1Upstream mutagenic primerAAAGACTACAAGCATTACAGA
002Upstream primerCAACTTGGATCCGATGATCCGATCBamHI
PGK-5pPGKUpstream primerCATACTAGTATCAGGGCCSpeI
PGK-3Downstream primerTAGGTCGTCATCTACC
  • a The SST2 upstream and downstream primers were used for PCR amplification of various portions of SST2 from pRS316-SST2 for subcloning into the two-hybrid vector, pAS2. The upstream primers amplified SST2 fragments initiating at amino acid 1 (SST2-U), 135 (SST2-7), 273 (SST2-1), and 410 (SST2-2). The downstream primers amplified SST2 fragments terminating at amino acid 271 (SST2-4), 333 (SST2-8), 401 (SST2-5), and 698 (SST2-3). The PGK primers were used for PCR amplication of various PGK-SST2 constructs for subcloning into pRS423. The mutagenic primers were used to construct the GPA1302S and SST2P20L mutants.

  • b Boldface letters indicate nucleotides that differ from the wild-type sequence, single underlines indicate the resulting restriction sites, and double underlines indicate an ATG initiation codon in upstream oligonucleotides or a termination codon in the reverse strand of downstream oligonucleotides.