TABLE 2

Clone number, accession number, and primer sequences of 38 ESTPs developed for this study

CloneaAccession no.bForward primerReverse primer
PtIFG_8419AA739501GCAACCTCCCATACCAAGACcgcgcggACCTTGTTGTGGATGGCG
PtIFG_8429AA739505GAGGCATTTATGAGGGAACGcgcgcggGTTGAAAGCGACTCCAAAGG
PtIFG_8436AA739508TGAACTTGTCGGTGCTTAGGcgcgcggGACAAGGATCCAACTCTCAGC
PtIFG_847lAA739529ggcccggcggAGTCAGAGGCCATGTTTTGGggcTGAACCACTACATTCCCCTCC
PtIFG_8473AA739526ccggccgggCTCTGGAGAACGACTGCAAGTACAGTAGCCTCTCTGGCCC
PtIFG_8480AA739530AGTGGCCAAAGAGATATGGGgcggccggTATTTCTTGCCCGAAGGC
PtIFG_8496AA739978cccggccgcGATCGGCGGTGGCATAAGAAATGTCATGTACGGACGGG
PtIFG_8500AA739539ggcccggcggGCAGATCGGACGATTAAAGGgccTCTGTACAAAACCGGATGGG
PtIFG_8520AA739553CGGAGTCATCTGTGTTTTGGGTCGGACATAAACTCATTTCTG
PtIFG_8531AA739558cccggccgcgTTCAGCTGGAAACACCTCACCTCGTGATAGCACAGCAAATACTC
PtIFG_8537AA739563cccggccgcgCATTCATTTGAGTGGCTGGGTAAAGTTCAGAACAATCCAACG
PtIFG_8540AA739564ggcccggcggGCACTGCTACTCCATTCTCGggccgcAACTGTGAAGCAATGGGGAC
PtIFG_8542AA739566ggcccggcggTTGGCATATGGAGGCATGgcGATGCCCAAAGCATGACATC
PtIFG_8560AA739577ggcccggcggccTGTTAGGGATGAGTATGCGCggccgCACTCTCTCAGGAAAAGCTCG
PtIFG_8568AA739584ggcccggcggTGAGGCCACTAGAGGAGACTGggccgTCCAATAGCAATTATAGCCAGC
PtIFG_8580AA739884ACTGGATTCCGGAGGATCACTGGAAACCGTCTACAGTCGC
PtIFG_8596AA739594cccggCTGCTGATGATCGAATCTGGAGCTAAAGTTGGCTGGCATC
PtIFG_8612AA739606GAAGGGCACTATGAAGCTGCgcggccggAACTAGGAATCCCAAATTCCC
PtIFG_8620AA739611gccgTGGATTGATAGGTCGGATGCggcccggcggCATTCGCATGGGAACATTG
PtIFG_8647AA739625ggccgggTTGGTCCGCTGATTGGAGACTTACGGTGGAGACCTTACAC
PtIFG_8650AA739628cccggccgccggcccCTCTCAAGGAGCCGAACAAGACC CTT GGA TTT TCC CGT C
PtIFG_8656AA739632gggcggcggcccAAGGTGTAATGGAAGGGTGCccggcgggAAAGATATCATTGCTGGCTATAC
PtIFG_8721AA739669cccggccgccggcccTGCCCAAGTGCAATCATGCGCTTGCTCAGATCATGG
PtIFG_8725AA739673AGCGCTGAATGATGTCTTGGgccgggcccggcCCAAACTTACACCATGCTCG
PtIFG_8732AA739680ggcccggcggccggTGAAGTTCTGAGTTTGGCGGgccATGCACAGGATGAACCCTTC
PtIFG_8736AA739683ggcccggcggccggTGGCATCACCAACCCAACgcTTCCAAATCGAGCGAAAATAG
PtIFG_8738AA739685gTCACAGACCTGAACACTGCGggcccggcggCCAAAACCGACTATCTTGGG
PtIFG_8747AA739692GCGGTTGGAAAATGTGCTAGggcccggcggGCTGCAATGCCAAGTACATC
PtIFG_8779AA739708ccggccgggAGGATTCGCGGTGAAAGGTCAAGTCAGTTGCTTGAACATC
PtIFG_8781AA739709ccggccgggGGTTTGCTCACATGTTCGTGTCCTTCATAAATGCATTCTCGTC
PtIFG_8837AA739754ccggccgggTCGGTTACTTGGGACCTACTGTCCCATGCAATATCATTTGTG
PtIFG_8843AA739759ccggccgggTCGCTGATGGCTTGAAGGCCACCGAAATATATGCCTGTC
PtIFG_9136AA739940gccggccgggcCCTTGTCCAAGACTGTAAGCCGATTTGAAACACACATTC
PtIFG_9155AA739957gcgcccgGTTGGTGTTAGGCAGTCATGGTGAAATTCCCAGCCCATATC
PtIFG_9164AA739966CAGCAAAGAGGCTTCAAAGGgcggccTACTGCGAATGCAACTCCAG
PtIFG_9198AA739984CGGCGGTGGCATAAGTTACgcggccgggTCCAAGTCTTCTCAATCCGG
PtIFG_92l7AA740001cccggccTCCAACTGTACAACAGCACCCTTCAAGCTTGATCCACAACG
PtNCS_6C12FAA556811GCCTGCTATCGAATCCAGAACCAGACAACCCAAATGAAGG
  • a Clone refers to the loblolly pine xylem cDNA from which the EST sequence was derived. Primer sequences are given 5′ to 3′. Lowercase letters denote nucleotides added as GC clamps and are not homologous to the corresponding EST sequence.

  • b GenBank accession number.