TABLE 1

Oligonucleotide primers used in cloning, sequencing, and injection constructs

Name of primerRestriction sitesgd cDNA sequenceOligonucleotide sequence (5′–3′)
5′ gd genomicXbaI, BglII−34 to 16agtcgtctagagatctattttcatcccgggcatt
3′ gd genomicEcoRI, KpnI15–33 past STOPagtccgaattcggtaccgcgttcccatacacattt
5′ gd codingSalI, BglII1–21aggtcgacagatctatgaggctgcacctggcggcg
3′ gd codingPstI, KpnI1584–1563agctgcagggtaccaattacaaaggccgtgatcca
gd seq.1179–196gagttacgctctcgatgc
gd seq.2379–397atgacccaaatccagttg
gd seq.3584–602acttgtcccaaagaacgg
gd seq.4781–799tggctagcggccatctat
gd seq.5981–999cgtcgatggcatttacat
gd seq.61181–1199acaggacgcgggatcaga
gd seq.71360–1377cgagatacgcatcagagc
gd seq.1.5232–249gagctactcacacgcggc
5′ tsgEcoRItsg 1266–1283agtcggaattcagcttggacctcatcata
gd 1244–1229(3′)1244–1229gcactggcatcggtgg
118.12251–235ttcgccgcgtgtgagtag
120.3427–411ccggtataaaggacaact
121.10633–616ctttggttcaccgattgc
121.12786–769tagccaaggccacgatcc
118.9Intron 4-1083acgcagtttaacacc
gd 3′ pro-enzNotI410–390agtcgtcaggcggccgctactacctaatgtgctccaactgg
3′ gd vWF eEcoRI749–736gcacggaattctactagctatcggcgctatc
5′ easter-gd catFusionea sig-gd catgcgaaatcatcggcgggcaagttgtcctttataccg
3′ gd cat-ea sig pepFusiongd cat-ea sigcggtataaaggacaacttgcccgccgatgatttcgc
easter 5′BglIIeaster 1–15gctgaagatctatgctaaagccatcg