TABLE 1

PCR primers, chromosomal locations, and PCR product sizes

NameAccessionPosition5′ primer sequence (5′–3′)3′ primer sequence (5′–3′)A.TaHuman diversitybChr.c loc.Product sized
FilledEmpty
Alu Yb9
Yb9NBC1AC02409126414–26105AGTATCTTTAGATCCAGGGTGAAGCTTCCAGTGGTAAGTCTATGGGAAT60FP1241186
Yb9NBC2AC024896142649–142362GCAGACAGTACCCACTTATTTTTGTTGGTTCTATAAAGCATTTGTTTCTTC55FP7462146
Yb9NBC3AC005342167963–167121GAAGCTCACTCTGCCATGTGCATGTTCGGTCCTGCTTACA60FP12527200
Yb9NBC6AC02090061455–61742GCAGACCGTATGTTCAATAAATGACCCACTTGGAAAAACACCCAAA55FP5493153
Yb9NBC7AC009062351148–351457CAGTAAATGATGGGAACAACCTTCCTAAATGTCAAGCTATGCCACAGA58HF1640383
Yb9NBC8AC011967156726–157013TAACTTTAGTTTTCCATCGCACATTACACTAGTTTTACCCTTGTCAGCAC60LF1841986
Yb9NBC9AC02219971329–71616AGCTTCCCATTTCTGGTTTGTCTATGCCTTGTTAAACCCAACCTTTT60FP17453120
Yb9NBC10AC02596122060–21773GTTTTCCTGGTGTGCCCTAAATATTTACCTAACTCACAAGACCCAAAG60IF4524197
Yb9NBC1lAC019189172700–172987AAAGACTTTTCAGGTTCTTGTAGCAATGCATGTCTATGCAAACTATCAAA55FP139274
Yb9NBC12AC011170158821–159108AACACCTGAGAAAGGCTCATTGGCTTTGGAAAATACCTAAGAAGCAC55LF1041493
Yb9NBC13AC00398536492–36792TCTAGTTTGGAGTGCCATGCCTCCCAGTCATGCTTCCTGT60FP7510167
Yb9NBC15AC00603624671–25059CCAAGGTTCAGCTTTATGCTCGCTCAAAACCGCTGAATTGT60FP7489159
Yb9NBC16AC02405713965–13678GAAGAAAGAATGGAAAGGGTAGTTGACCCCCATGACACTAATTTACCTAT553416117
Yb9NBC1 7AC01266422598–22311ACTTACCCAAAACGCATGATTCAACGTAGATGCAGACAACACTCTTT60FP2709391
Yb9NBC18AC00575135038–35343CGTTTGAAAGCTACGTTACCTCCCATGAGGTAGTGATGAT60FP16531203
Yb9NBC21AL13608133392–33083TTCATGTAGCCAAAACTACCTGTTCTTAACAGCTTACAGTTTGGCAGAG52FP6425107
Yb9NBC22AL139193160587–160874TGCACAACTATACACCAGACACTGTTGTCTCCCATCAGTAGAACCTAAG55LF14435110
Yb9NBC23AL35675680321–80034CAGGACTTTTATTGAATCCTCACCTAAAGAGAGACATGGCCCAATTA58FP1441283
Yb9NBC25AC00855890385–90099GAGTTGTCAAATTTGGAATGGATACACATCATTAAGCTCTTCCTGACATT55FP5496159
Yb9NBC27AC01196613523–13810CATGGATAACATCATAAGGCTTCAGACACTAGTTTTACCCTTGTCAGCAC55LF15482149
Yb9NBC28AC00480825856–26143AAAAAGGTGTGCCTGGATATTTACTGTGGCATAACTCAAACTGTAATG55FP7539208
Yb9NBC29AC00500829772–30089GTAATATGAGGTGATGGGGGTTACTGGTGAAAGAAGAACCCCTAAGTTAT60LF7474138
Yb9NBC30AC00300335922–36249GAACCCCATCCATTCTCTTACAGTGGCAAAATATTGGCGACT60IF16508156
Yb9NBC31AF10725858225–58541TTTCTCAGCACTATCCCTGTGACAGTGAGTTGGCAGTACC56FP21457130
Yb9NBC32AL121582154486–154199CCTAACCCCTACATTTTACCATTTCGTCATTTGCACTTGTCAAAGAGTGT55FP20469141
Yb9NBC34AL12184128487–28800CCAAGTTTCCTCTGCTGGAACACAAATACTCCCTGCCTCAG55FP1448990
Yb9NBC35AC040906166712–167029TTAACAGCTTACAGTTTGGCAGAGTTCATGTAGCCAAAACTACCTGTTC60FP6427109
Yb9NBC36AF01572515626–15909AAGCAGTCATCATCCATTTTACCACAAAAATGCACTTACC60FP21521201
Yb9NBC37AB0144603311–3621CAAAATGGCCGTGTTCTTTTGTGTCCACGGATCTTTGCAG62FP16458142
Yb9NBC39AC00454212799–13104AGAGGATCTTTGCAGGCACTGTGCTGTGGGGTTAGGAAGA5522509176
Yb9NBC40AP00023760117–60404AGTGAGTTGGCAGTACCCAAATCTCAGCACTATCCCTGTTCTTACAT60FP21450124
Yb9NBC41AC0041404672–4851TGTTTCCTCATCTGCCAACTTAAAAGACTGTTGATGACCACTCAG55FP7761389
Yb9NBC42AC004945152516–152833GACATCTCCCTCCTTTCTCTGAAAACCTGAACATGGGTAA55FP7521177
Yb9NBC44AC00656113793–13506GACTACAACATACCATCCTCAAAGGGTATAGGAAACAGCGTGTTGTGAC55FP12426106
Yb9NBC45AL12197817555–17268GGAGAACCACTTGAACATGGAGAGCCCTGCTATATCCAGCTCTT606486167
Yb9NBC48Z9511430489–30202GCTGCATACCAGACCTTTGTCTTGTGCTGTAAGGCTGAGTAGG60FP22432117
Yb9NBC49AC005375129358–129604ATCCTTTAGATCAGAGGTCATCAAGCAACAACTAATCTGCTTTCTGTCAC58FP17393134
Yb9NBC50AL10986528485–28772GTTCCACAAGTACAGGAGAAAATGTGAAGCTCTTTAGGAAACCAAATCTC55IF11460138
Yb9NBC53AQ382257185–472GGGACTGGGTATAAATGAGGTGGGACCAATCCTACCTTGTATGG55HF2045468
Yb9NBC54AL05030539695–40005TAGGATGAGAATGAACTTTGAGATGCCATTTATAACCAATGACGACAAAG58FPX492172
Yb9NBC55AQ07635591–379CTCAGATAAGGAAACTGAAACACAGCCTATACCTTAAAACAAGCTTGGAC60FP1425108
Yb9NBC58AC022199109996–109711TTGACTGTAACGTCACTTTATTTGCTGACTAGTGCTTTTGTGTATTGAGAA60FP17445128
Yb9NBC59AL121582149776–150063GTTTTCTCAGTCTCTTGCATTTTGGGGGTGCAGAGACCAAAAACTT55FP20480160
Yc1NBC1AC0112964067–3787AGTACGTGAGGTTTCTATGCCTTGGATTTGTCCATAATAGCCCCTAACT60IF7481159
Yc1NBC2AC006195139237–139517TCTCTCATGAACATAGATACAAACGTGCATTCTTGAGATAAAT60IF7443102
Yc1NBC3AC01007248921–49201GGATACCCCTTGGGAAAAGAGAACACCATGTAACCCTCACC63FP1440592
Yc1NBC6AC00401682266–81986CAAACTCTGTGCACCTTGACACACTCGCATTATGGATTTTGG65FP71009677
Yc1NBC8AC00729828402–28682CATCAAACCCCACACACTCATCCTTGGAGCCACATGTTTT63FP12463115
Yc1NBC9AL12160331558–31838GCCCAGCTGGAAATAGCTTAGAAATTCTGCATGTGTCTCAG63IF14490159
Yc1NBC1 1AF12346293456–93176GGGAATGTTCATAGGACATGGTGGAACATGCCAGAAAGAGA63FP14778437
Yc1NBC13AL12200669774–70054TCCCAAGTCCCATCCCTTAGAAGCCATTCCTCACCAGCCATT60FP1504165
Yc1NBC1 4AL031734146718–146998TGAGGTCCTGTGACTTGGTGTCGCAAAGCATTTCTCAAAG60FP1464149
Yc1NBC15AL03165085392–85112GGAATGGCATAGGAAGTGGAACCAAATGAAAGGGGAGACA63FP20418112
Yc1NBC20AP001696246018–246298GCAAGTAATGAAAGGATTCTAGGGAGAGCTGCCCTATTTCTT60FP21486163
Yc1NBC23AC00462628992–29271TGCTCAGGTTAGGGATGTTAATGCTTCTGAGCTGCTGGGGGACT60LF16445120
Yc1NBC24AL13701369320–69041TCAAAGGGGAATACTGGGGAAAGGGGAAATGACAATCAAGTGGAA60FPX40888
Yc1NBC25AC01863772620–72340GGGCAGGGGATGTAGGGACTTGCCCCTGTTTCATCTGTGC60FP7432108
Yc1NBC26AC027279127822–128102TCACTTCAGAAGGGGAAAAATGTGGTCGCCTGGACTTCAA60FP16472165
Yc1NBC28AC01701930139–29859TGGTGAGTTCCTGGTCTTGCTGTGCTCACTCTTTGGGTCCACAC60Y41499
Yc1NBC30AL15775637868–38148GCCGCTAGCCTTTGTGTAAACAAAGTCATCTCTGACCCCCAGA60FP14497177
Yc1NBC31AC008062103843–103563TTCTGTAAAAGCCTGTTAGGTCCACAGCATTTCACTGTCAGCATTGG60LF7443110
Yc1NBC32AC00586637960–37680GCGAGGGCAAGCAGACAATAAGTGGAGCTCACCCCTTCAGA55FP12425114
Yc1NBC33AL13299440508–40788CTTTATGGGTCTTACAGTAGAATGCATATGTAGCCTCTGATTC60FP14500186
Yc1NBC34AL13638287933–87653CCCACAACCCTTTCCCAGAGCAGCAACCTGGATGGAGTGG601477165
Yc1NBC35AC00463832778–33058CCCATTCTCCATGCCGTGATTGCAAGGCATTGGGGATACA60IF16481162
Yc1NBC36AL12190324409–24129CACAGGAACTATTCCCCACAAGCGAAATTCTTGAAGGAAAAACTGG60FP20437101
Yc1NBC37AL04956225982–25702CGTGCATTCCTTCTCATCACAGGCACTTTTACCTAAAGAGCTTACA60FPX40688
Yc1NBC38AC00011810509–10789TCCAAACCTCTCTTGTTTGGATTGAAAGGATTTATGCCAGGTG60FP7435113
Yc1NBC39AP001695126848–127128TCCAGGAAGCAAACAGAATTCAGAGTCAACCCCACTCTGATGCTCAA60FP21623291
Yc1NBC45AF2188911964–1684TGGCCACATTGGAATTCAAAACTATTTCCTGCTGCTAAGTGACACATGA60FP2040194
Yc1NBC46Z8606156824–57103CTTTGAAGCATGCAAGGAAAGGCAGTTTCCAATCTTAGGGACTTGA60FPX489172
Yc1NBC48AC00709466892–66612TTCACCACAATTAATAGGAAGGTTTCAAACGCAGCACAGGATCTGA60FP7700392
Yc1NBC49AC01149352071–51791TGTGCTGTTACTATGGAGCCCTACCTGGGGAGACATCCCCTTCC601941394
Yc1NBC50AC01038250258–49978GGTATGGGGCCAAATTTAATCCATCCAAGAGAAGCCAAACCTACAGA60IF5406101
Yc1NBC51AC009415123638–123918TCATACAAAAGACAGGCTTTGCCAAGGGAACAGATTCAGAAGAAACA55LF7521208
Yc1NBC52AC002429141029–140749GCTTTTGACACATCCCCAGGTCACAAGATTTGGGGCCAAGAG62FP7429111
Yc1NBC53AC00484843020–42740AAAGCTATCAACCATGCCAACAGAAAATGCTATTTTGGGGAATG62IF7505186
Yc1NBC56AC006017155231–154951TCTGTAAAAGTGCTTCACATGGGGGTGTGATATTCGTGCTG557593287
Yc1NBC58AL13336783515–83795TGCTGCATCAATCAGCCAGATCCCAGTCCTTGGCAACCAT65FP14427118
Yc1NBC59AC00621358483–58763ACCCTCCCCTCCTTCTGTGGCCCTGCAGAACGCTGGAAAA60FP1942893
Yc1NBC60AL13631930378–30658GAAACCGCCAAGATTCTCACCTCTCCATCATGATTCCCAACTGA60IF10522205
Yc1NBC63AL12196457663–57943GGTACTCAGTAACACATCAAGAAAGCTGGGTGGTGGGTTCAC60IF6502181
Yc1NBC64AL12190425022–25262CAGATCCTGGTTCGTAGGAGGTGCAAGCTGTGTATTCTTGATACTGC60IF20600292
Yc1NBC65AL04964346216–45936TTGGCTGAGGATATCAGATGTGTTCCAGTGCTTAAGAGTAAAGCAAGC60FPX456152
Yc1NBC66AJ00699811416–11136GGCCTAGCAAGGTCTTTTGCTGATGAGTGTACAAGCCACACTT60FP21422110
Yc1NBC69AB02085919030–19310CCCACATTTATCAGTACCTACACCTTGCAGAATAGCAATGAT55IF8524210
Yc1NBC70AL13323824939–24661AGCAATTGTGGAGCCAGGAAGAGGGTGCTTAGTGGGAGCAAA60FP14452137
Yc1RG60AC019215161766–162046TCCCACATTTCAGTGTGAATTTGGCATTTGGGATAGTTCCTG60HF8474159
Yc1RG62AC007428139021–139301GCTCAACATGCATAACCTTGAACATTTCCAAAGAAACCCCTGACT60FPp522216
Yc1RG83AC009004751–1030CTGGCTGGGAGATTTTGTTAAAGTTGGAAACAGTGTATTGCCTGTA60FP19724397
Yc1RG64AC00928965992–66272TCCAGTCATCTTAATGTGCCTTAGGGATAGACCTTGCCTTTCTGATT60FP1438067
Yc1RG65AC01918163269–63549GCAGCCTGGATATCAATTAAGGATGGGTTAAAACTCCTAGCACTG60FP2735413
Yc1RG66AC0095067323–7615CTTTTTCTCAGACTGTGCTTGCGCAACAAGACAAAACAGCAACTG60FP1419109
Yc1RG67AC008039178981–179192AAACTACCTTCCCCAGACTCCCCCTAAGGACTTTATAATGGGACT60FP7382125
Yc1RG68AC008039164672–164954ATGGTGTCCACAAGAAACTGAGGGAAGGCTCCATTATAGGTCTTG60IF7480166
Yc1RG70AC0063233461–3741CTCTGCAGCATGACAAATCAATCAGCATCTAAAGCACTCACTTCA60FP17504178
Yc1RG7lAC01145098261–98574TACTGAAGACCAGTGGGCACAATTCCACTCACCTTACCCAGATTA60FP1943573
Yc1RG73AC007739154145–154426ATTGCCAAGAACCTTGTGTTTCGGGGTTGAGAAAAAGTTCAGTG60FP2463143
Yc1RG74AC00603873850–74014AACTACCGTAGAATGGGCAAAATGAATGGATGGAAAACCAACATAA60FP2415226
Yc1RG77AC00578319041–19327GAGAAAGAGCTGCAAGGATGTCCAAGTAAGGCCCAAATGAGGT60FP1940184
Yc1RG78AC00204413430–13712CTCCAGGATCTGCTTTCATCTTATCATGGTAACTAGCACAAGATCC60FP16431119
Yc1RG79AC00469035856–36140GGGTCTATCATCACCTTAATTTTGATGGTTTTTAGATGCCAAACACTAT60FP7497158
Yc1RG80AC00448574445–74724CAGAAATTGGTCCTTACAGTTTCCAGAGGTGAACAGTTATTGCCTGA60FP7482134
Yc1RG81AF0882191767000–176982CACACAGCAGCAGTTACAAAAACCTTCTAGGCTTTAGTTGGGGAAG60FP17535354
Yc1RG82AF08821999726–100005CCTGGACCTTTAGGCATTTTTCAGTCATCTCATCTTCACAGCAC60FP1738891
Yc1RG83AC00502682038–82232GCAGTAATGGTGGCCTGTTATAGGGAAACTGTTAATGCTTCCCTCT60FP7389153
Yc1RG84AF13121750031–50317CCACTTGCCACTCCTATGGTATAAAATGCACAGGAATAGCGTTC60FP2138760
Yc1RG86AC00541278372–78652ATTGGGTGACCAGTTGTATTGACCTTCTGGAGGGGAACTGTTTTTA60FP17499188
Yc1RG87AC00807184205–84487GAACATGTGAACACATTGCTAGGAATGTACCTTCAAAGTCACACAGC60FP742792
Yc1RG88AC00630513802–14086GGTGACTCTCAACCCTAACTTCAGTGGATTCCCGACAGAAGTATT60FP1839574
Yc1RG90AC00467168017–68298CCTTAATAATTTCCCCCGGATTGCTGTAGGGGCTAAAATACCAAC60FP12398100
Yc1RG91AC00528837818–38107AATGGGTGAAAAGAGGTAGAAGGTGTGTCCTTAACAAAGAGGATGG60FP17700391
Yc1RG92AC00467578485–78767ACACTCTATGCAGGCAGTCATCTCCTGGACCTTTAGGCATTTTT60FP1740285
Yc1RG93AC005324137294–137574GGGATTCAAGTGTGGGTAGAATAAGGAAGGCAATATGATGTGG60LF1737763
Yc1RG95AL04953738717–38997ACCTAACAGATGACCTGCTGAAAGAGGTAGAGAAAGGCAAGCATTC60IF20701390
Yc1RG96AF04209161095–61379ACACACAACCTGAAAACTCAACCCCACACCAGCATGTTATTTGAT60FP21457128
Yc1RG97AF04209042069–42352AAGTGCACACTTTGACGTTCACCCTTGATTGGCATTCAGGTTTA60HF2144188
Yc1RG98U920323903–4188TCTTATCTCTGACACCTGACACGAAAGAACCCAGAGCTATGACAGA60FP6442113
Yc1RG99AL02216385835–86116AAAGCACTTGGTACAGAATCAGCCCATGGCGAAGTTAATGAGAAGT60IFX39064
Yc1RGlOOAL35487286112–86401ACTTCCATGAGCTAGTGGCTGTAGATCTCTAAACGATAAAGGCTCAC60LF1474143
Yc1RG101AL03166226328–26613CCAGCCAAAGAGATTACCAAAAGTCCAGTCCATTTCTCAAAGAAG60HF20541235
Yc1RG102AL158040201136–201376CTGCCTTTGTAGTAAATGTCAAGGGTAGACATTCGCTCCACCTTTAT60FP10414110
Yc1RG103AL158157101226–101505GGCATTTGCATTCTGATGCTTAGACATGTTAGAGAAAAGGTGACATC60HF938379
Yc1RG104AL15738487495–87786CTGGAAGGGATCTTTTCTTATGGCCCTTTTCTGATCCTATTCTCCA60FP9438130
Yc1RG107AL358293139195–139492GTTTGATCAGCTGTCCTCAGACTTGAATGAATTTTTGAGTTGGTGA60FP1439976
Yc1RG108AL03545829348–29629GTTATATGAACAAAGCCCGGTAGACCAAAAGAACCGAGAAGAAAC60FP2038171
Yc1RG109AL13779436815–37094GCTAGAATTCATAATGGAACCATCCTCCAGTTGAGTTGGAGTGATTT60FP1502188
Yc1RGllOAL109824732–1012CTAGGGTTAAGGAGTCCCTTGGGTGACCTAGGCCAGAGGTTAATG60FP2039585
Yc1RG113AL16327890774–91055CTGTACCGCTAAGAGCTTCTGTGGATATCTCAGCAGAATGGCAGAC60FP2137676
Yc1RG114Z9805136444–36724ATCAGGCATACAGTCTGAAAAGCAATCTTGGTTAGTGTGAGTCAACC60FPX426110
Yc1RG115Z9804660991–61271GTTCTGCTGTTTGGATCTGGAATGTGGTGAAGGTACAGACTCATCC60FPX39272
Yc1RG116AL078621142330–142621GGTTAAAAGAACACATGGGATGGGAAAGGTGGGTGTCTAAATGCTA60FP2241999
Yc1RGll7AL09686142260–42540GAATAACCCAAACTTGGTAGGTGTGCAATAAAGAGTGTTCCTCTCC60FPX490166
Yc1RG118Z7118321436–21716TACACAGACCAATGGGGAAAGTATCCAGATCCATGACATAACACT60FP2238989
Yc1RG120AL02328361027–61306TCTGCTCTTGCTATACACTGCTGGAAGGCAGTGAATGAGACACTCT60FP6499194
Yc1RG121AL10976024171–24451CATGGACATTTGGGAGAATGTACGCCCCTATAATTACTCAGCAG60FP439892
Yc1RG123AL02388216690–16970CACACACACACACAAAATTAGCCGTGAGTCTTGAAACGGCTTTTAC60LF16563234
Yc1RG124AL02239718401–18681AAATCACTGTACCAACCCTGTCAGCAAACACCACTGAAGCATAAA60FP139779
Yc1RG125X76070298–578TGTTCTCTTCCTGTCTCCATTTCCTGTTTCTATGATCTTGAAGGATGG60IF241597
Yc1RG126AP001752250076–250356CCCTGTAGTAATGGCTCAGTGAAGGCGATTTAGGCATAGACATAGA60FP2141591
Yc2NBC1AC002430108794–109074ACATAGTGGGCATTCAAGAGCTTAATGTTTCCATTTCTCCA55IF7467131
Yc2NBC5AC007384128277–128557GAAGGAATACAGGGAGGAATCTCCCAAACAACTTAAAACC55IF7461125
Yc2NBC9Z9805136444–36724GAAAAGCCTGATACTTTTGGCTTGGTTAGTGTGAGTCAACC55FPX40791
Yc2NBC1lZ696669696–9416CGACAAGTGACTAACCTTACGCTC CTC CAATGATCTATGTGT55FP1640982
Yc2NBC13AC007882150095–149815TGGGATAATGATTTGTCTCCAACATGTGGCAGATGATGA60FP1640789
Yc2NBC15AC007541129217–129497GGTAAGGCAAAACCAAGTAAGTTTTGAGGAAGCTGATGAC55FP1241092
Yc2NBC17AC00554174313–74593ATCAAATGGCAGCCTTACTGGTTTTCCATTCCTGAGTTA60FP740182
Yc2NBC19AL02216381833–82113GCTTAAAGCACTTGGTACAGATGGCGAAGTTAATGAGAAGT55HFX39367
  • Perfect matches to the consensus are in italics.

  • a Amplification of each locus required 2 hr 30 min at 94° initial denaturing and 32 cYc1es for 1 min 94°, 1 annealing temperature (A.T.), and 1 min elongation at 72°. A final extension time of 10 min at 72° was also used.

  • b Allele frequency was C1assified as fixed present (FP), low (LF), intermediate (IF), or high frequency (HF) insertion polymorphism. Fixed present: every individual tested had the Alu element in both chromosomes. Low frequency insertion polymorphism: the absence of the element from all individuals tested, except for one or two homozygous or heterozygous individuals. Intermediate frequency insertion polymorphism: the Alu element is variable as to its presence or absence in at least one population. High frequency insertion polymorphism: the element is present in all individuals in the populations tested, except for one or two heterozygous or absent individuals. –, indeterminable.

  • c Chromosomal location determined from accession information or by PCR analysis of NIGMS monochromosomal hybrid cell line DNA samples.

  • d Empty product sizes calculated by removing the Alu element and one direct repeat from the filled sites that were identified.