TABLE 2

Primers used in this study

Primer nameDNA sequence (5′ → 3′)
A. Primers for PCR disruptions
REV3: ZETADISLGTCGAACGACACAATACAGAGCGATACGGTTAGATCATCCTCTAAATCACGTACGCTGCAGGTCGAC
ZETADISRGACACGAGAGTAAAATACTGGACAGTCATATGAATTGCATTTACTAGCATCGATGAATTCGAGCTCG
POL4: POL4DISLAGTGGTAATAAGTAAAGGATAAACATGCGACCTGTTAGACAAATCGCCGTACGCTGCAGGTCGAC
POL4DISRTAAGCTATAAAGATACAAGCCCAAGTCGCATAAAATTCAAATTATTGAGCATCGATGAATTCGAGCTCG
RAD30: DISRAD30LCAAAGCATGTCAAAATTTACTTGGAAGGAGTTGATTCAGCTTGGTTCCCGTACGCTGCAGGTCGAC
DISRAD30RTTGGAAGATGTAACTTGTTTCTTCTGAGGTGTGGCAGTATGTTGTGAGATCGATGAATTCGAGCTCG
B. Primers for site-directed mutagenesisa
pol1-Y869A-LG GAC TTT AAT TCT TTG GCT CCA TCT ATT ATC CAG G
pol1-Y951A-LGCC AAT TCT ATG GCT GGT TGT TTG GGT TAT G
pol2-Y654A-LGAT GTC GCC TCT ATG GCC CCA AAC ATC ATG AC
pol2-Y831A-LGTT ATT TTG AAT TCG TTT GCT GGG TAT GTT ATG AGG
pol3-Y631A-LG GAT TTC AAT TCT TTA GCT CCA AGT ATT ATG ATG G
pol3-Y708A-LGCT AAC TCT GTC GCT GGT TTT ACA GGA GCG
rev3-Y980AGAT TTC CAA TCA TTG GCT CCA TCC ATT ATG ATT GG
rev3-Y1093AGCG AAT GTC ACC GCC GGT TAT ACA TCA GCT TC
C. Primers for detecting Polα mutationsb
Set 1: al 869Y WTLA GTC ATG GAC TTT AAT TCT TTG TA
al 869A LGTC ATG GAC TTT AAT TCT TTG GC
al 951Y WTRATC AAC ATA ACC CAA ACA ACC ATA
al 951A RC AAC ATA ACC CAA ACA ACC AGC
D. Primers for detecting Polε mutationsb
Set 1: ep 645Y WTLAT GTA GAT GTC GCC TCT ATG TA
ep 645A LGTA GAT GTC GCC TCT ATG GC
ep 831Y WTRCC TTT CCT CAT AAC ATA CCC ATA
ep 831A RC TTT CCT CAT AAC ATA CCC AGC
Set 2: ZABAMGCTGTTACTCAATCTAAGCTAGG
R645RealDetWTATTTGTAGTCATGATGTTTGGGTA
R645RealDetAlaGTAGTCATGATGTTTGGGGC
E. Primers for detecting Polε mutationsb
Set 1: de 631Y WTLCA ACT TTG GAT TTC AAT TCT TTA TA
de 631A LA ACT TTG GAT TTC AAT TCT TTA GC
de 708Y WTRC CGT CGC TCC TGT AAA ACC ATA
de 708A RGT CGC TCC TGT AAA ACC AGC
Set 2: ZAECOVTAACTTTATCATCAAAGTTGATCC
DEL631READET-WTGCGCCATCATAATACTTGGATA
DEL631READET-ALAGCCATCATAATACTTGGAGC
F. Primers for detecting Polξ mutationsb
Set 1: ze 980Y WTLGTGCTGGATTTCCAATCATTGTA
ze 980A LGCTGGATTTCCAATCATTGGC
ze 1093YWTRAATGAAGCTGATGTATAACCGTA
ze 1093A RTGAAGCTGATGTATAACCGGC
  • a The primers shown are for the coding strand, with the alanine codon in boldface.

  • b Terminal bases critical for discrimination between wild-type and mutant sequences in PCR reactions are in boldface and underlined.