TABLE 1

Primer sequences and PCR conditions for 19 C. gigas microsatelite loci

LocusGenBank accession no.Primer sequences, 5′ to 3′ (forward/reverse)Temp.[MgCl2] (mm)
ucdCgi1aGATCGTTACTGTCAGTTGCTCTGCGGTGCTATTATGAACCA55°1.25
ucdCgi2bTTGCAGGAAGCAAGAGATGACTTGTTAACTGCCGGTGAGG55°2
ucdCgi3aTTGAATGAACATCGTTTGGATCATAGAATAAACAGAAC50°2
ucdCgi4aAF051170ATAATAATTAAAGGGGTTAAGGGG57°1
GTGGTAGCAATTGTGTCCTATG
ucdCgi6bAF051172AAGCAACTATCAGTTTTTGGTAGC55°2
AATGAGCTGACAGTTCATAGGC
ucdCgi8aAF0F1175AAGAAGTTTGCATTATTAGTAGCAACTTGTGTAAAGCATCTG50°1.25
ucdCgi9bTTAAACTTGTGTAAAGCATTTGGCGTTCATCGATTTTCGCAAT53°2
ucdCgi10bTGCACCAATTTGAGATGTGAACTGAGTTTGAAAATGTCACCG50°1.5
ucdCgi14aAF051174ACTCGGCGAAACTTCTAATAC50°1.25
TTAGCTGCCGCTCAAGTTTT
ucdCgi18bTCCATGTTTACTGCTACTTTTGG50°1.5
AAATGCTGTGCAGAGAAGCC
ucdCgi21bGCCCTCTAAATTAAAATCTCTCTCCGCCATAGGTTTGAAAATT50°1
ucdCgi22aGGAAGAGGAATAGTCTACTTATGCGTCAGACGTTCCTAACTCTTC43°1.75
ucdCgi24aCAGAGAGCCGGACTATTTCGCTCTTTGACACTATGCCGA45°1
ucdCgi28bAF051178TGTTTAATGATGTGTACCGCG53°1.25
ATCAAATTGGCTGTATTTACAGTG
CG49cY12086CATCAGGGGTAAATTAAAGTAAGCCCACAGACGATTTCATATATCCTG55°2
CG108cY12087ATATGTAATGATTACGAAACTCGTATGAGATTTGGTTCCACC55°1.5
L10dAF170850GGTCAATTCAAAGTCAATTTCCCCATGTTTTCCCTTGACTGATCC55°1
L16dAF170851CGGACGAATAAGATATTTGGTCTGGATCTGCGCATCATCTCG57°1
L48dAF170852TCAAACCATCTGCTCGTCTACGTCCGAAAATCCAGGAATACCGG60°1.5
  • a Primers modified from those in McGoldrick (1997) and McGoldrick et al. (2000).

  • b Primers taken directly from McGoldrick (1997) and McGoldrick et al. (2000).

  • c Magoulas et al. (1998).

  • d Huvet et al. (2000).