TABLE 2

Informative CAPS markers berween Col-gl1 and Kas-1 generated for this study

Primers
MarkerEnzymeForward primerReverse primer
CD3-69(PCR)aNcoI5′ TTCATAGCTCGGCGTCTGAAG 3′5′ CCTTCACCAACTCTATAAATG 3′
CIC3D2RbRsaI5′ ATCGTCTTTGAACCGGACCTT 3′5′ ATACCAAGTGTCAATGACACC 3′
CIC3D2LbTaqI5′ CAATACTAGCGCAAGCTGTCA 3′5′ TCAGCGTAGGCATAGCTTTG 3′
CIC11G6RbSacI5′ TTTGGACCTTGTGCTTGCTTC 3′5′ ATAAGGTGGACAGCGAAGTAG 3′
M005SbHindIII5′ GTGATCTTTACTTCACTAATG 3′5′ TTTATCCTTCCCTCTCCTAG 3′
CIC8E1Rbc 5′ GAATCAGTAACAAACATTTCTATG 3′5′ CACCGAAGAAGAATCCATGTT 3′
  • a Publicly available (Fabri and Schaffer 1994) and mapped with the 129 F6(Col-gll × Kas-1) RIL to the top of chromosome IV.

  • b Developed from publicly available YAC end sequence and used to fine map RPW10 to the bottom of chromosome III.

  • c SSLP marker.