TABLE 2

Type I and EST loci containing microsatellite polymorphism in channel catfish populations

LocusGeneRepeatInf.a
mei.
Primers (5′-3′)Referenceb
Acta1α-Actinaat216ACCATCACCAGAGTCCAGGAIpCG0001 (AF228714)
GTCCCAGCCATGTATGTG
B0102D12EST from catfish brain cDNA librarygata144CCGTTGCCTCAGGATGGAAAIpCG0037
ATCAGATGCAGACCAGATCATAG
B0105H01EST from catfish brain cDNA libraryaaat211CACATGGGTGATAAGTGTTGGGIpCG0013 (Z34530)
GGTGCTATGATAGATGCTCACG
B0108B10EST from catfish brain cDNA librarygaa288ACGAATCACAATGCACACCGAAIpCG0237
TCTGACCCCAACTTCCTAACA
B2mβ 2-Microglobulinat272ACTAACGAGGTAATGGATAGAAATGCriscitiello et al. (1998)
AAAAAGTGGATGACACATAGGG
CT-53Leukocyte-specific basic proteinaat144GATACGTGTAGGTGCGTGTAChen (1999)
CTCCAAGCAGATATTTTTATTA
EsrEstrogen receptoraat189TTGTCATCGTGACCGTGTACXia et al. (1999)
TACGGAGCACAGAACATCAC
GHGrowth hormoneaat196AGATTTGACGTCCTGTGTGTAATang et al. (1993)
TAAATCTCAGCCGTAACCGC
Hox six6Homeobox six6aaat0ATTCTAGAGTCGGACCTTACGCIpCG0098 (AF030281)
AGTCGTTTATGGATTGTGCAGAA
IgHImmunoglobin heavy chainca136TAGTGATGAGTTCGTATTCTGCGhaffari and Lobb (1989)
AGATTCCAAACCATGTACTGAG
Icpu-UAAMHC class 1ca215ATTGCTGTAAAATGGGATTATTAGAAntao et al. (1999)
TTCAGGAAGTGTGCACGAGG
Icpu-DAAMHC class 2αgt284AGACGCTTGACACCAGGACAGodwin et al. (2000)
GACACACACTGGGGAGATCA
Icpu-DABMHC class 2βaac/cac278CTGTGATTACCTGCTAGATACCGodwin et al. (1997)
TGTGTGAGAGTTCATCTAGGTGS. Quiniou (personal comm.)
Isl-2Insulin gene enhancer proteinaat0AGTCTGCTTTGCTCTCGCCIpCG0086 (AK001022)
GCAGCACAACTACGCAAGATG
Nccr-1Nonspecific cytotoxic cell receptor protein-1aaac136ATAATTTGCACAGTGGACATGGL. Jaso-Friedmann (personal comm.) (AF159718)
GACCAACACCTTAACCACTG
NrampNatural resistance associated macrophage proteinac142CCTTCTACAATAAAACCAACATGGChen (1999)
CACGTTTAAAAGTTAAAAGGTGCAC
OrOdorant receptor gene clusteraaat0TAATGCCCCAGTATAGTGACAAIpCG0140 (AF112374)
TCTAGAGTCGGGGGTATACC
Otf2Pou domain, class 2, transcription factor 2ct129AGGTTTAGTGGCACGCGGTCRoss et al. (1998)
GATCATTAATCAGCTCTTTCCTC
Pp2a0Protein phosphatase 2A0 B′ regulatory subunitaaat216AAGTCGAAGAGCACACAGCACIpCG0117 (U38192)
ATCAAAGGCACAGAAGACCATG
RarB2Retinoic acid receptor βcct94GAGCGACGGTGCTGTTCAAAIpCG0206 (X56573)
AATCACTTACATTACATCTGTTGC
  • a Informative meioses.

  • b GenBank accession number is in parentheses.