TABLE 1

Aedes aegypti cDNA genes analyzed in this study

Gene nameAccession
no.
TaSizeForward/reverse primer sequencePrimer
location
A. aegypti
linkage
location
Drosophila
genome
no.
Drosophila
physical location
(chromosome
no., Mb)
Chromosome 1
    Hemepoly (hemolymph polypeptide)aU1123560385CGACAAGCGCCAGCAGAAGG39I, 0CG61861, 29
AGTTGGCCGGGTCCACTTCG423
    LF198T5831948284CTGGCGTAGATTCCGTGCTG52I, 1CG22861, 9
TCCGTGTTGACGTAGGTGGC235
    Erudi (enhancer of rudimentary)aU6686946444CGGACGAAGCTGAATGAAGA13I, 4CG18711, 10
TCCGCTAACTGATCCACGAA456
    Sialokin1 (salivary vasodilatory protein-sialokinin1)AF10809960298CCCGATAAATCCTTTCCTTC83I, 4NS
AAATGGGTATCCCTTTCCTG380
    Immuno (immunophilin)aAI61895760360AAATCTCGCACCCGTAAA22I, 4NS
GCCCTCGTCAAAGTTCAG381
    Cathbp (cathepsin b-like thiol protease)aL4194060343CAAATTCGGAACCTCACCAG133I, 7CG109921, 15
TATCCACCCTTGCATCCATC475
    LF090T5832048145AGCAGAATGGCTCCCCGTAA31I, 13bCG15271, 9
ATGGTTTCCTTGCCGGACAG175
    VitgRecp (vitellogenin receptor)AI65018860308CCTCTGCAAGAAGCCGATGT246I, 13NS
ACCCAGTCGTGGCTGTTGAT553
    Transfer (transferrin precursor)AF01911760309ATGCGGCCATCCAGGTTCAG146I, 14CG61861, 20
CCCGCCGACTTCAGTTTCGT454
    Allatod, Allatode (allatotropin), Rf1-5aU6531443289GAACGGATGCTAGAAGAAAG193II, 32NS
TTAGAATGGGACTACCGAGA481I, 44
II, 1
I, 22
III, 14
    Hexam2 (hexamerin 2)U8608056436TTCCTGGTGAAGCAGAAACA100I, 25CG6806
TCATGCCATAGAATCCTTGC535
    WhiteaU8885159TACCTGACSGCACTGCTGATTGI, 30CG43143L, 16
TGATGACMGGCGGCCCAAC
    Riboptl1 (Ribosomal protein L1)AI65843956285AGAATCTTGCGTTGCCGTAC137I, 30CG55023R, 48
GCTTCAGGGTTCACGTTGAT421
    Feilai-405 (SINE)a, Rf6aAF10766746206GATGTTCGACGCTCAGTTGT13I, 30CG54092R, 39
GTTGGTGATGATACCGTGCT218II, 19
    Aamy2 (α-amylase 2)U0120860330ATGACGTTGGAGTGCGAATC40I, 32CG186402R, 39
ACCAGGTTGCCGTAGATGAA369
    BMIOP (blood meal-induced ovarian protein)aU8424860337TTGAAGTCGTCGTTGCTGTT196I, 32CG57092R, 46
CTGCCTTTGTCATGTTTGCT532
    Chitan 1 (chitinase 1)aAF02649160327AAACTGACCTACGCCCAAAG687I, 33CG93572R, 45
GTCTACGCCGATGAACGAAT1013
    CG18355AI65001059258GATGCTAATGGGAAACAAAT250I, 35CG183552L, 8
TGATACCGTTTAAGGCAAAG507
    Peroxnc (peroxinectin)AI65754658305GCATTTCAGCAGGGTAGA130I, 35CG76603R, 38
AAGATCGGCAAGAACTCA434
    PPallost (preproallatostatin)U6684160326AAGAAGAAGATTACGACGAT16I, 36NS
CAATTTCCCACTATCACTTA341
    AbdA (abdominal a)X6713248367AGCGGTAGATCCTGTTGTCT868I, 59CG103253R, 37
AACCTCCAACTCACCTGTTC1234
Chromosome 2
    Vmem 15a1 (vitelline membrane protein 15a-1)S5455554383TCTTGGCAATCTTCGCTCTG74II, 0NS
ATCGCGTTCCGTGTCTCATA456
    Vmem15a (vitelline membrane protein 15a)U9168254332TGAGCGACGGATAGAACTAA313II, 5NS
TACGCCAGCTAGGAAATGTA644
    TrypB (trypsin–Barillas Mury)M7781460339ACGGCTACCCTCGGTCAGTT93II, 6CG115293L, 12
CTACCTCGCGGTCGGTAAAG431
    Fxa (FXA-directed anticoagulant precursor)AF05013346200TTAGCACCAATCCAGCCTCA214II, 7NS
TGGCACAACTGTTGGGAAGA413
    LF233T5832748218AAAGCGCCCACCTTTGCC38II, 9NS
ATCGCCCGTCAGCTTCAGTC255
    ADPATPtla, ADPATPtlb (ADP/ATP translocase)AI65754057284CTGGCGCTACTTCATGGGTA14II, 9CG169441, 12
AI650176ATCGAGGTGTTCTTCGGGTC297II, 27
AI650113
    Aamy1 (α-amylase 1)AF00056960437GGACTTTGTACGCGAATCTG350II, 10CG178762R, 39
TAAGCTGGAGCATGTGGATC786
    Mle (male-less)AI65022259303GTTTGATGACCCACCAGAA40II, 14CG116802R, 25
ACAGACCAACGCAGAGCA342
    D7 (D7 salivary gland protein)aM3315660342CCTAGATTTGGCCCAGTTGT753II, 16NS
ACTCGGGCTCTGATTTGGTA1094
    LF138T5833260192AATCTGTTCGACGTGGTATG1II, 19bCG72692L, 6
CCGGCAATTCGGTGATGTT192
    TrypEarl (trypsin-early)X6436260459CCAACGGTGGCATCATAGTGAAAG295II, 19CG32292L, 3
GATCCATTGGCGAACAGTGGAGAC753
    MtATPsyn (mitochondrial ATP synthase subunit-α)AI65013758251CCACAGCCGTCGAAGAAACC83II, 19CG36122R, 47
CGTCACCGATGCTCAACACG333
    InsRecp (insulin receptor)aU7293946313AGCAGCGGCAGGATCGGTAG24II, 19CG38373R, 35
CGCGGAACAGCAGCAGGTAC336
    CarboxA (carboxypeptidase A)aAF16592354378TTGAATTGTAATGGGTTGAG68II, 20CG176332L, 10
TTATGATAGGAATCGCTTTG445
    Glusyn (glutamine synthetase)aAI64998354441ATTCAGAGTTGTGGGATTAT306II, 22bCG17431, 13
CATTAAAGCACGTTTGTTAG746
    Sin3 (transcription factor, sin3)aAI56137058454GTATCTGTTCCTGCGGTTGC46II, 39CG88152R, 35
CCTGAAGTGCTGCTTCTGCT499
Chromosome 3
    Apolipo2 (apolipophorin 2)aAF03865454329GCTGGAATCGGTCAAACTCG24III, 0CG110644, 1
CCGGCCTTAACTTGCTGGTA352
    Apyr1 (apyrase1)aL1238954470GGAATGTGACGGCGGATTT351III, 0bCG48372R, 40
TGGATCATGCGGCTGTTTG820
    AspSyn (asparagine synthetase)aU8411860297GGTCGAACAATGTGCGGTAT88III, 2NS
TGATTTCCTGTGCCATCAGC384
    Dynein (cytoplasmic dynein heavy chain)AI61890056276ATGGGATGCTTTGGTTACTC110III, 6CG75073L, 5
TACTTTCTCAGCGTTGTTCG385
    UGALS (UGALS vitellogenin)aU0254860328AGGGCTACAATCCTGGCTAT80III, 7CG38862R, 35
GTATTCTGGCTGCTTGACGT407
    Hsp70 (heat-shock protein 70)AI65841856342CCCGTCCTACGTGGCGTTCA257III, 8CG42643R, 36
GGTGGCCTGACGTTGCGAGT598
    LF227T5832351189AAAGTTCGTCCGGTGTCCAA43III, 10NS
TCTTCTTCAGGAGAACCGTG231
    RNAhelic (ATP-dependent RNA helicase 46)aAI65016258399TTTGACTTCATGGACCCTCC109III, 11CG111072R, 30
AACTGTGACGCACATTGTCG507
    Gpd-1 (glycerol-3-phosphate dehydrogenase)AI64830859239TGTTCAAATGGAGGAAATGC132III, 12CG82562R, 38
CACCACCGTGGATCAGCT370
    VitgConv (vitellogenin convertase)aL4637360287TGCACAGAAGACCACCAATG30III, 12CG107723R, 46
TCGACTGTTCCGCTGAGTTA316
    Malt (maltase)M3044248234GGACTGGTGGGAACATGGAA72III, 13CG86962R, 31
CTTATCGGACAACCGCTGGA305
    Vitg (vitellogenin)aL4184260296AGATGGCGTCTTCGGTAAAG41III, 15AE003820
AGTGAGCACGGAACCTTTGT336
    DefA1 (defensinA1)aAF15608854193CATTTGTTTCCTGGCTCTGT88III, 18CG13852R, 32
GAGCAGCACAAGCACTATC280
    TrypLate (trypsin-late)X6436360325TGGCTTTGAAGTGCCCGTTGAG44III, 20CG95642L, 9
CAAGTTCCTTCGTTGACCGGAGTG368
    Apyr2 (apyrase2)aL4139154317TGATTGCATCGTCGTTGATT103III, 37CG19611, 12
CAACTTGCGCTGTTTGTTTT419
Monomorphic Loci
    Aahr31 (steroid hormone receptor homolog aahr31)U8754360384TGGGAGGGAGAAACCAATAC292MCG118232R, 32
AACTCCAGCTTGCCAACAAC675
    Aahr33 (steroid hormone receptor homolog aahr33)AF10670360332AGATCCTCCGATTATTCCTA543MCG11823
TCATACCTCAAATCCCTTCT874
    ATPaseB (V-ATPase B)AF09293456195GGTGTCACGCGGCAAGTTTA110MCG111544, 1
AGTCGTGGCTGCGAGATGAA304
    ATPaseC (V-ATPase C)AF00892451408TTCCAGCGGGACCGAACAGT94MCG31612R, 26
CACCGGCATCACCGACGATA501
    Atub (α-tubulin)AI64999558264CGGTGTCCAGATCGGTAATG137MCG19133R, 28
ACCACGGGCGTAGTTGTTAG400
    Btub (β-tubulin)AI65753858266AACATGGAATCGACGCCACC294MCG92772R, 41
TTGCGGACAACGTCCAACAC559
    Carbox (carboxypeptidase)M7945254403CAAGAAGCTAATGCGAGGAT111MCG45723R, 40
TATCGGTGAAACTGAATCCC513
    Chitan2 (chitinase2)AI61267060344TGCGTCTATGGTGAGTTCAA21MNS
TATCGCAGCTCTTATGAGGA364
    Chymotrp (chymotrypsin)AI61895660319CCAGTTTGGCACTCGCTTCC55MCG7142
GACGGCAATGTCATCGGGAC373
    Cinnabar (kynureninehydroxylase-white)AF04095748202TGTGCGCTAAGAACTACCAT79MNS
TTTAGCTGACTACGCCCATT280
    Ddc (dopa decarboxylase)AI63891460386CGTACCGAAATGCAAGCC113MCG36862R, 26
GAACTCCTCTGGCAGTCCAA498
    Ecdyrecp (ecdysteroid receptor)U0202160283GACTCGCGTGGATTGAACGG393MCG17652R, 25
TCTGCACCAGCCGAAGAAGC675
    Ef1α (elongation factor 1α)AI65845956172AGCCCAGGAAATGGGTAAGG206MCG18733R, 52
CCTGCGATGTTCCGGTAATC377
    Ef2 (elongation factor 2)AI65839158200TCCGATCCTATGGTGCAGTG158MCG22382R, 21
CAGACGGTTGTGCTTGTTGG357
    FerritinL3708256367AGGTGGAAGCAATACGACTG24MCG22163R, 50
GCGGCATACTTCAGGTAGAT390
    GST2 (glutathiones-transferase-2)S4331156112GCTTTATCACTTTCCGATGT3MNS
AATTCACAAACGGTTCTTGC114
    G3PDH (glyceraldehyde-3-phosphate dehydrogenase)AI65011260218TTCCTGTACCACCAACTGCT332MCG88931, 17
CTGGAATGACCTTACCGACA540
    Hexam1 (hexamerin 1)U8607960294TCCAGCATGTCCACCAGCAC65MCG25591, 14
AGCATGGCGACCGTTACAGC358
    Hsp71 (heat-shock protein 71)AI65841856240GCCATGCAGCGTCTGAAGGA190MCG4264
CATACCACCGGCCAGGAGAA429
    Hsp83 (heat-shock protein 83)AI65844156163ACATGGAAATCAACCCTGAC10MCG12423L, 3
CTTGACCATACGGTAAATGC172
    LAP (lysosomal aspartic protease)M9518756437TCGTTTGCTTGGCCGTTCTA141MCG15482R, 30
TGGCTTCAGCGAAGGTTTGT577
    MucinAF12598460408GACAGCACCCACAGGCAAAT114MNS
GCTCCTTTCAACGGGACCTT521
    NucTrn4a (nuclear transcription factor 4a)AI61895448418CTGTGGCTACATACCTTCGC344MNS
TACTATCCACGGACTGCTCC761
    Odh-1 [octanol dehydrogenase (E.C.1.1.1.73.)]AI64998559249CCGAAGGCTGGTGAGGTA190MCG65983R, 31
CGGGCAAAGGTTGGTTTT438
    OER (ovarian ecdysteroidogenic hormone)AI61902948367AGCCATCCAGGATCAATCTC17MNS
CACCGAAGACCAACTGTGAA383
    Perox (peroxidase)AF09871757433CTACGGGTGTCGGGAAGCAA5MCG40093R, 37
TAGGCGCTCAGGAATGGGAC437
    Polyubq (polyubiquitin)AI64833458359AGCTCCTCATTGTGCAGTTT155MCG116243L, 4
CGTTATCACTTTCCGTTGGT513
    PyrCarb (pyruvate carboxylase)L3653056451CCCCGTGTCAGAATTTGGTC117M
CCATCAGTTCCGGGTACGAT567
    Rdl (dieldrin resistance)U2880348441GGGGTGACCAATAAAGCAAG97MCG105373L, 9
TGCGTCGTCTAAATGGATGG537
    Retro (retroposon reverse transcriptase pseudogene)U0935958149ATGGTCAAATGGCAGCGTAC127MNS
CAAACTGGACATTCGGGAGA275
    Riboptl3 (ribosomal protein L3)AI65842956347ATTGCGTTGCCGTCACCAAG307M
ACCGATGCAGCAGCCTTTGA653
    SGA30k (salivary gland allergen–30 kd)AF00192758334ATTCTGTCTGGTAGGCATTG41MNS
TGTCTTCAGCGTTAGCTTCT374
    SOD (superoxide dismutase)Cloned48151TGACAACACCAACGGATGCA37M
CGGACAAGGAAATCTGACTG187
    Ty7 (ras-like GTPase)R1956054218GCTTGCTGGATTAGAAACTC170MCG59153R, 44
TAACCACTTATTGAAGGCAC387
    VCP (vitellogenic cathepsin-b-like protease)AF12759260360GCCCGCTACCAGGACAATCA122MCG109921, 15
CTGAAACGGCCCAGCAGGAT481
    Vmem15a2 (vitelline membrane protein 15a-2)S5455660277GTCCTCTTCACCGCCGTCAT10MNS
ATCGGGTTGGGTGGTCTGGT286
  • Listed with each gene are the GenBank accession number, optimal annealing temperature (Ta) and the approximate size of the amplified product. Also listed are the sequences and locations of the oligonucleotide primers relative to the GenBank sequence, the location of the genes in the A. aegypti linkage map, the accession number of the homologue in the Drosophila Genome Project, and its physical location in the Drosophila genome.

  • a During SSCP analysis of PCR products, we usually heat product/buffer mixtures at 95° for 5 min and plunge them in ice for an additional 5 min to allow for intrastrand complex formation before loading onto the gel. However, for the loci indicated, better resolution was obtained without heating and cooling.

  • b These loci were not used in mapping because their genotypes failed to fit expected Mendelian ratios.