TABLE 2

Names, primer sequences, and characteristics of single-locus markers

Marker namePrimer
direction
Primer Sequences
(5′-3′)
Fragment
size (bp)
Annealing
temperature
[MgCl]
(mm)
SL_1010ForwardGCTTTCATACAACTCTACAGTTG956471.5
ReverseCATCAAAGACCTTCTGCGGAG
SL_810ForwardGACAAATGGATTACACTTACATGG657471.3
ReverseGCGTGTGAGCCATTATCAGCAG
SL_375ForwardTGGTTTCAGATTTGTCCCAG310451.5
ReverseGGTCCCACCCACTAGATG
SL_850ForwardCACCAAAGTCGCTTGTGAGTGGA701511.5
ReverseGCTCAGTAAAAACCTTCTTCAGGG
SL_305ForwardGTTTATGAAATCAAATATCATTCC260451.5
ReverseGTAGATCCTTATTGTAAAGAGAC
SL_840ForwardCCTTATACTGGCATGTTGCACG308481.5
ReverseCCATTCTCGATGAAAGAGTCAG
SL_245ForwardTGAGGCTGAAGTCGTCCGTAC219492.0
ReverseGGACGTCGCAAATTTGACCAC
SL_330ForwardGAGCCAGAAAATCCCTGGC283452
ReverseGATTTCTCAAAAGGCTCTGTAG
SL_585ForwardCTCGACATAGGCGTCGGCA531492.0
ReverseCTCATTAGCCACTCGTCAGTG
SL_730ForwardACGTACCTTGAACGTAAGTG658431.5
ReverseGCGAAATAGTTCTTCACGAC