TABLE 2

Primers used to isolate conifer genomic sequences from corresponding cDNAs

Gene namePrimer namePrimer sequencePositiona
AgfEαbisbagc1.7F5′ ACTTCAAAGATGCCAATGGG 3′nt 1134-1114
AG1/06R5′ TGATTACAGTGGCAGCGGTTC 3′nt 2439-2429
AG1/05F5′ GCTGGCGTTTCTGCTGTATC 3′nt 3-21
AG1/14R5′ GCCAAGAAGTCTTCAGCGCG 3′nt 1361-1341
AG1/16R5′ TGTTGTTCCAGTCACTGG 3′nt 1314-1294
Agg-pinAG3/03F5′ TTCTACCGCACCGTTGGC 3′nt 12-29
AG3/04R5′ AACCCGACATAGCATAGG 3′nt 1924-1907
AgfδselAG4/01F5′ ATGGCTGAGATTTCTGAATC 3′nt 1-20
AG4/02R5′ GACCATCACTATTCCTCC 3′nt 1753-1737
Agg-limAG10/01F5′ GGCAGGAATCCATGGCTCTCCTT 3′nt -1 to 24
AG10/02R5′ GAATAGTCTAGATTATAGACTTCCCAC 3′nt 1985-1960
AgggabiAG22/03F5′ TGCTCATCATCTAACTGC 3′nt 45-62
AG22/04R5′ ACACAATACCATGAGGGC 3′nt 2645-2628
Tbggtaxtax1/01F5′ GAATTCCTTCCCCTGCCTCTCTGG 3′cnt -21 to 5
tax1/02R5′ GCTCTAGAGCGCCAATACAATAATAAGTC 3′cnt 2642-2624
  • a Number one and positive numbers represent ATG start site and downstream nucleotides (nt), respectively, designed from cDNA; minus numbers are upstream of the ATG start site.

  • b Sequencing the bisabolene synthase genomic sequence was accomplished by sequencing two overlapping fragments designated pAGg1-1 (1.7F and 06R) and pAGg1-11A (05F and 14R, 16R).

  • c Restriction enzyme (EcoRI or XbaI) sites were incorporated at the termini of these primers for cloning purposes.