TABLE 1

PCR and sequencing primers for new X-linked loci used in this study

LocusForward (5′ to 3′)Reverse (5′ to 3′)
YellowGTTGCGAGGTTTTAGGACTGACAATGGTAACTGCCGTGCTAA
SNF1AGTGGCCGTCAAGATACTCAATAAGGTTAGCAAGCAGGTTTAT
BroadAAAAAGTTGGAGAGGGGTAGTCAACAACAGCGAATCACATAA
ArmadilloTCCAACAATGCGACTCTCACTAAGAGGGTTTCGCTCACACTG
ActininCAAAAATAGCACAAGGGAAATGAGGAGTGGGAGAATAGAAGC
PgdAATGTGCAAAGGGGAACGATATCCGAGTAAATCCACCTGAAA
VinculinTTGGGTCAGAGGGCTAAACTTCTCCGCTCGTTTGTTTCTTCG
ZesteCCCTCCTTGTTGTCGTTATTGTTCTGCATCACTAATCTATCG
PeriodCCAAAAAGTGAGACCATAAGTGAATAAGCTGAAAATACCAAG
WhiteAGAGCAGCGGCGGATAAAATGATGGGTGGTGGGAGTGACAAG