TABLE 3

Oligonucleotide primers used for the verification of gene deletions

Name of primerSequence of primera
G1-RHO3Δ1CACGCGAGGGTACTTTCCG
G4-RHO3 Δ 1 GGCGTGATGGCGCTCTCGTT
G1-RHO3 Δ 2 GTCCGTGATCACCAGTGGTG
G4-RHO3 Δ 2 CGCCAACCAGTGAACGTTGGCAGC
G1-RHO1 GTATCAGGAGAAAATTGGTG
G4-RHO1 CAAGATGATCGGAACACCC
I1-RHO1ATGCCCAGCCGTATCCCAAAGCG
G1-CDC42Δ1GTCAGCCGTACACGTTGGGC
G4-CDC42 Δ 1 GGTCAAGGCCGAGCACTCC
CA-CDC42 Δ 2 GTTTCATTCAGAGCAGTAGAGTG
G4-CDC42 Δ 2 GGTCTCGCGCGGGTCCTGG
G1-CDC24 CGGATTGGTGCTCTTTTTATGC
G4-CDC24 CAGAGCAGTTTGTAACTCCTTAGT
G2gtttagtctgaccatctcatctg
G3tcgcagaccgataccaggatc
  • a Uppercase sequences correspond to regions upstream (G1-) and downstream (G4-) or within (I1-RHO1) the loci targeted for disruption. Lowercase sequences (G2 and G3) correspond to internal sites of GEN3 used for verification PCR of the 5′ and 3′ novel joints generated upon integration.