TABLE 2

D14Jax STS markers used in this study

MarkerProductForwardReverse
D14Jax1 162TAAGTCATGCCACATGCTGGGGCCTTTTACCTTAGGCAGG
D14Jax3 387AAGAGGACGTCTACCATGGCTTGGAGCTGGAGTCATAGGC
D14Jax4 228CATAGTGGCACACTCAATGCATTATGGTGGAAGCTGTGGC
D14Jax6 216TTGGTGCTTCTCAGCACTTCACCTTTGATCCCAGCACTTG
D14Jax7 268CACCTCTAACTGCATCTTAGGGTGGGTGTGTACATTGGACA
D14Jax9 605CCTGAACAGTCACATATCTTGCCATCTTTCTATCTCTCTGTC
D14Jax10 360CACCTCTTTAGTCACTCCTGATCTGTGCGTAGACTTCTTTG
D14Jax11 320GACCTCACAGTTCATCCATGTGAACTGCTTCACAGTGCTG
D14Jax12 260TGAAAGAGAATAGCCTCAAGCTATTCCAGTCTCTGAGCAGC
D14Jax13 240TGGTCTGTGACACAGCTAAGACTGGAAATTAGGTCATGACC
D14Jax14 340CGAGACGTGATGGTGTAAAGTCTAACAGGACTGCACTGAG
D14Jax15 160CGGGACTTAAATGCACTGACAGGCCAGTCACAAGTAAGCACAAACCTC
D14Jax16 255TTTTTTGCTGGAGGCAGGACTCCTATAATTTGGGGGGAGGGGCAGAG
D14Jax21 240CTCTGTGTCACAGGTAAGGTGGAATCCGATGTCCGCACAGAC

Product sizes are in base pairs. Forward and reverse PCR primers were derived from BAC end sequences.