TABLE 1

New CAPS markers used in the PEX5 cloning

Size of products (bp)
MarkerEnzymeCol-0LerOligonucleotides
PDC2 BamHI360, 65425CAGTGGATCACTCCCAAGACGCCTC
GCACTCAACTTATATATATTTCAG
MDA7AluI931, 312931, 170, 142GACCTAATGATGCTTGACCCATG
GCAGAATCTAGGGTTACGTGGC

PDC2 and MDA7 are CAPS markers (Konieczny and Ausubel 1993) that reveal polymorphisms when cut with the indicated restriction enzymes following amplification. PCR conditions for PDC2 were 40 cycles of 15 sec at 94°, 15 sec at 55°, and 30 sec at 72°; PCR conditions for MDA7 were 40 cycles of 30 sec at 94°, 30 sec at 55°, and 3 min at 72°. Products were visualized following electrophoresis on 4% agarose gels. In MDA7, Ws products are the same as Ler; amplification of Ws DNA was not observed with the PDC2 marker.