TABLE 1

Primer sequences, GenBank accession numbers, annealing temperatures (Ta), and anticipated PCR product size for each of the loci used to map MIB and MEB QTL in A. aegypti

Locus name (accession no.)PCR product sizeTaPos.+aForward primerPos.–aReverse primer
A. Sequence-tagged RAPD markers
    B18.359 (AF191675)360541CCACAGCAGTGTCGGTAGGAG340CCACAGCAGTACACAAATGGG
    B18.349 (AF191676)318541CCACAGCAGTAGAGGCGGTAG298CCACAGCAGTCAATGGAGCTT
    B18.366 (AF191677)364541CCACAGCAGTACAGTTCGAG344CCACAGCAGTGATTAAGATT
    B20.220 (AF191678)218541GGACCCTTACGACCATAATGG198TGACCCTTACCGTGTTAT
    B20.448, B20.1300 (AF191679)376541GGCCCTTACACGATTCGCAG356GGACCCTTACCCTACTGCTT
B. TAG microsatellites
    TAG66 repeats (AF191668-74)421TTACAGCTTGGATTTGTTCTVariableGAAACGAGAAGAAAACTCAT
C. cDNAs
    Lf90 (T58320)1654831AGCAGAATGGCTCCCCGTAA175ATGGTTTCCTTGCCGGACAG
    Lf198 (T58319)2044852CTGGCGTAGATTCCGTGCTG235TCCGTGTTGACGTAGGTGGC
    White-eye (U88851)600591968TACCTGACSGCACTGCTGATTG2089TGATGACMGGCGGCCCAAC
    Fxa (AF050133)22046214TTAGCACCAATCCAGCCTCA413TGGCACAACTGTTGGGAAGA
    Early trypsin (X64362)48360295CCAACGGTGGCATCATAGTGAA753GATCCATTGGCGAACAGTGGA
    CarboxypeptidaseA (AF165923)3985468TTGAATTGTAATGGGTTGAG445TTATGATAGGAATCGCTTTG
    ADP/ATP translocase (AI657540)3045814CTGGCGCTACTTCATGGGTA297ATCGAGGTGTTCTTCGGGTC
    Apolipophorin2 (AF038654)3495424GCTGGAATCGGTCAAACTCG352CCGGCCTTAACTTGCTGGTA
    Late trypsin (X64363)3496044TGGCTTTGAAGTGCCCGTTGAG368CAAGTTCCTTCGTTGACCGGAGTG
    Allatotropin (U65314)39243193GAACGGATGCTAGAAGAAAG481TTAGAATGGGACTACCGAGA
    Maltase (M30442)2544872GGACTGGTGGGAACATGGAA305CTTATCGGACAACCGCTGGA
    Defensin (AF156088)2135488CATTTGTTTCCTGGCTCTGT280GAGCAGCACAAGCACTATC
    Apyrasel (L12389)48954351GGAATGTGACGGCGGATTT820TGGATCATGCGGCTGTTTG
    Apyrase2 (L41391)33754103TGATTGCATCGTCGTTGATT419CAACTTGCGCTGTTTGTTTT
D. RAPD primersPCR product sizePrimer sequenceNo. of loci
A09GGGTAACGCC12
A20GTTGCGATCC11
B15GGAGGGTGTT1
B16TTTGCCCGGA2
B18CCACAGCAGT5
C03GGGGGTCTTT10
C04CCGCATCTAC2
C13AAGCCTCGTC5
C19GTTGCCAGCC8
56
  • a Nucleotide position of the 5′ end of each primer in the GenBank sequence.