TABLE 2

Extra sequences inserted in P-element footprints

SequenceP-element 5′ endInsertion and flanking sequenceP-element 3′ end
Reference sequenceCATGATGAAATAACATAP element sequenceTATGTTATTTCATCATG
AaCATGATGAAATAACATAATCATACATATTATAACATATGTTATTTCATCATG
BCATGATGAAATAACATATTATTAATATATTATTAATATTATTAATAACATGTTATTTCATCATG
CCATGATGAAATAACAAATGTTTTTGTTATTATTAACATGTTATTTCATCATG
DCATGATGAAATAACATATGTTATATATGTTATAACATATATGTTATTTCATCATG
ECATGATGAAATAACATTGTTATGTTATGTTATTTCATCATG
FCATGATGAAATAACATGTTAACATGTTATTTCATCATG
GCATGATGAAATAACATAATATGTTATAATAATAATATAATAATATGTTATATAATAATGTTATTTCATCATG
HCATGATGAAATAACATGTTATTTATTTCATCATG
ICATGATGAAATAACATAACATGAAATGTTATTTCATCATG
JCATGATGAAATAACATATGTTATTATGATATTATATGATTATTATATGATGTTATTTCATCATG
KCATGATGAAATAACATGATATGTTATTTCATCATG
LCATGATGAAATAACA TAAGGTTATTTCATGATGTTATTTCATCATG
MCATGATGAAATAACAACATGTTATTTCATCATG
NCATGATGAAATAACATATGTTATATATGTTATATGTTATTTCATCATG
OCATGATGAAATAATATATTCCCGTTATTTCATCATG
PCATGATGAAATATTTCATAATATTTCATAATATATTATTTCATCATG
  • a The sequences are lettered to correspond with those identified in Figures 2 and 3 as containing a sequence in addition to the P-element end.