TABLE 4

Sequences at the ends of linear excised transposons

Flanking region in T-DNA5′ Ac end
No. of Independent clonesGCGTGACCCAGGGATGAAAGTAGGATGGGAAAATCCCGTACCGACCGTTATCGTATAACCGAT
Additional nucleotidesSequences of the clones
2gAAAGTAGGATGGGAAAATCCCGTACCGACCGTTATCGTATAACCGAT
1AGGATGGGAAAATCCCGTACCGACCGTTATCGTATAACCGAT
1ggATGGGAAAATCCCGTACCGACCGTTATCGTATAACCGAT
1AAAATCCCGTACCGACCGTTATCGTATAACCGAT
1CCCGTACCGACCGTTATCGTATAACCGAT
1gTACCGACCGTTATCGTATAACCGAT
1ACCGACCGTTATCGTATAACCGAT
1gACCGTTATCGTATAACCGAT
1CGTTATCGTATAACCGAT
1gTTATCGTATAACCGAT
1ATAACCGAT
1AACCGAT
1CCGAT
1CCCTAAGTGTATACAGGGATGAAAGTAGGATGGGAAAATCCCGTACCGACCGTTATCGTATAACCGAT
1AGATACATGTGCTCAGGGATGAAAGTAGGATGGGAAAATCCCGTACCGACCGTTATCGTATAACCGAT
1ACGGCCGCGCTCAGGGATGAAAGTAGGATGGGAAAATCCCGTACCGACCGTTATCGTATAACCGAT
1CGACCCTGTATAGGGAGCAGGGATGAAAGTAGGATGGGAAAATCCCGTACCGACCGTTATCGTATAACCGAT
1gACCCAGGGATGAAAGTAGGATGGGAAAATCCCGTACCGACCGTTATCGTATAACCGAT
1TTACCGACCGTTTTCATCCCTAGTCCAGGGATGAAAGTAGGATGGGAAAATCCCGTACCGACCGTTATCGTATAACCGAT
3′ Ac end Flanking region in T-DNA
No. of independent clonesAAAATGAAAACGGTAGAGGTATTTTACCGACCGTTACCGACGTTTTCATCCCTA GCGTGACC
Sequences of the clonesAdditional nucleotides
1AAAATGAAAACGGTAGAGGTATTTTACCGACCGTTACCGACCGTTTTc
2AAAATGAAAACGGTAGAGGTATTTTACCGACCGTTAcc
1AAAATGAAAACGGTAGAGGTATTTTACCGACCGTTACCGACCGTTTTCATCCTA ATCATCTGAT
  • Additional nucleotides corresponding to the flanking regions are underlined in boldface type. G or C nucleotides at the termini of clones are shown in lowercase, because they can be assigned to both the added Poly (C) tail and Ac sequences.