TABLE 3

Sequences of joined Ac ends obtained by excision from pAcGUS construct

No. of independent clonesFlanking seqAcFlanking seq
AATAAATCTCAG .......... CTACCCGTTCG
TTATTTAGA ← GTC .......... GAT → GGGCAAGC
Conceptual head-to-head joining of Ac ends
CGACCGTTTTCATCCCTACAGGGATGAAAGTAGGA
Sequences of the PCR clones
1CGACCGTTTTCATCCCTACCAGGGATGAAAGTAGGA
2CGACCGTTTTCATCCCTA*CA*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*CC(33)GG*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*TC(53)CT*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*C A(314)TT*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*T(113)TT*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*CT*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*AT*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*TA(114)AC*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*GT(40)AG*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*TA(17)CA*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*GGAGC*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*TT(111)GTAGGA
1CGACCGTTTTCATCCCTA*CCC(21)GGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTAGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*CCATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*TGAAAAGTAGGA
1CGACCGTTTTCATCCCAGGGATGAAAGTAGGA
1CGACCGTTTTC(30)TC*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCAGGGATGAAAGTAGGA
1Deletion of 34 bpCAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTGG(41)AG*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTGT(12)TT*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTGCTCATG*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCACCA*CAGGGATGAAAGTAGGA
1Deletion of 18 bpCAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCCAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTGG*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCAGGGATGAAAGTAGGA
1Deletion of 29 bp(17)TT*CAGGGATGAAAGTAGGA
1Deletion of 31 bpGCT*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTGGGATGAAAGTAGGA
1CGACCGTTTTCATCCAGGGATGAAAGTAGGA
1CAGGGATGAAAGTAGGA
  • Nucleotides within the inserts that correspond to the flanking regions are shown as underlined boldface type. Numbers in brackets correspond to the number of base pairs.

  • * Informative ends used for statistical analysis.