TABLE 2

Sequences of joined Ac ends obtained by excision from pAGS4411 construct

No. of independent clonesFlanking seqAcFlanking seq
....GCGTGACCCAG..........CTAGCGTGACC....
...CGCACTGG ← GTC..........GAT → CGCACTGG....
Conceptual head-to-head joining of Ac ends
CGACCGTTTTCATCCCTACAGGGATGAAAGTAGGA
Sequences of the PCR clones
1CGACCGTTTTCATCCCTAGCAGGGATGAAAGTAGGA
5CGACCGTTTTCATCCCTACCAGGGATGAAAGTAGGA
1CGACCGTTTTCACCAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTATCAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTATTAGGA
5CGACCGTTTTCATCCCTA*GC*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*CT*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*AG*CAGGGATGAAAGTAGGA
1CGACCGTCAC*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*ATC*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*CAG*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*GGTC*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTACAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCTAAAGTAGGA
1CGACCGTA
1CGACCGTTTTCATCCGGATGAAAGTAGGA
1CGACCGTTTTCAGATGAAAGTAGGA
1CGACCGTTTTCATCAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTAAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTAGGGATGAAAGTAGGA
1CGACCGCAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCGGATGAAAGTAGGA
4CGACCGTTTTCATCCCAGGGATGAAAGTAGGA
1Deletion of 19AGGA
1CGACCGTTTTCATCCCTA*TA(29)GC*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*GA(20)ACdeletion of 18
1CGACCGTTTTCATCCCTA*TG(11)GGAAGTAGGA
1CGACCGTTGG(19)AC*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*CC(66)TAdeletion of 31
1CGACCGTTTTCATCCGT(17)CC*CAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTA*GG(41)TA*CAGGGATGAAAGTAGGA
1CGACCGTTTGA(64)AG*CAGGGATGAAAGTAGGA
1Deletion of 38CA(34)AA*CAGGGATGAAAGTAGGA
  • Nucleotides within the inserts that correspond to the flanking regions are shown as underlined boldface type. Numbers in brackets correspond to the number of base pairs.

  • * Informative ends used for statistical analysis.