TABLE 1

Sequences of joined Ds ends obtained by plasmid rescue

No. of independent clones/nameConceptual head-to-head joining of Ac ends
CGACCGTTTTCATCCCTACAGGGATGAAAGTAGGA
Sequences of the PCR clones
1/r3CGACCGTTTTCATCCCTA700 bpCAGGGATGAAAGTAGGA
1DEL of 21 bpDEL of 30 bp
1DEL of 23 bp TTTTCATCCAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTAAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTAACAGGGATGAAAGTAGGA
1CGACCGTTTTCATCCCTATCAGGGATGAAAGTAGGA
1/r5CGACCGTTTTCATCCCTA1040 bpCAGGGATGAAAGTAGGA
  • The sequence of the regions flanking Ds element is not shown, since the plants used for rescue experiments contained already secondary transposition events.