TABLE 2

List of EST and STS markers mapped by PCR-RFLP

No.GeneLGPrimer forwardPrimer reversePolymorphismDDBJ/GenBank accession no.
1Act-c8AGCCGAGAGGGAAATTGTCCGTCAACTGCAGATGCCTGGGGTGMspID89627
2Act-m3CTGCTGAGCGTGAGATCGTGGTTTTCACAGCCTCTGTCTCCGFokID87740
3B2m23ATGAAAGAGCTTTTCTTCATTGCCTGGCCAGGGTCATGACTGTACACin/delAB006593
4Bf/C214GCTCAACATCTACATTCGCCTTGACAACTTCATACACATCARsaID84063
CCTCTTTGGAAACAGACTTCACAGCTCAGCAGGT
5Blue5TCCTGTGTGTCGAAGGCCTCCACAGACTTTTGAGACTTCAGTGGTTGAin/delAB001602
6C3-11GCAGAGATGCTTTGAATATTTTATTCTGCACACATCTTTTACCAHinfIAB025575
7C3-21GCAGAGATGCTTTGAATTTTCCACTGGGCCTTGGTAAAATHphIAB025576
8C416TGTGCAGAAAGACCCTGCTATAAGGTGGTGTTATGGCGGAGGCAAGin/delAB025577
9Casp3A10TGATATACGGCACTGATGGTCCGGGGTGCTCCTCCACGAGTAATAGCCN1aIIIAB032609
10Casp3B1CAGATTAAACAGCTTTTGACTGATGGTTGACTCAAAAGGATGCAGACGAin/delAB032608
11DAB18GTCTGGAGAGAAAATCTCCTGTCTGACTCTGGCATGGACGGGTin/delAB033212
12dd00122CCATCAACACCAGCAGTAATCAGGACAGGTTGTGTTTTTGAAATTTGCEcoRIAB033201
13dd0047CAGTCACAGCAAGGCTCTCCGTCCAAAGTGCACGACTTCCin/delAB032765
14dd0076CTCCCCTCTTAAGGCAAAGATGCAGTTTATCCCGTCTCAACTGMnlIAB033202
15dd00922CCACAGACCCAAGACTGGGCCAGCTGATGAATGGTAATGCMspIAB033203
16dd0247GTTCCTGTCAGCAGCGTATTTAGCCATAAAGAAGAACAACCCAFokIAB033204
17dd03915TGGGAGTGGTGTAGGACTTCTTTGTTAAACGAAGGGGCTTGTTAGin/delAB033205
18dd0481ACGGTTCTTCTCCTGTGGTCTAAACAATACAAACTGAGACCCTGCAllele specificAB033206
19Ef-IA11AATGTGGAGTCCTATCAGAGGACACGTGTTACTCCCACin/delAB020734
20Eya311CCAACTGTTTGATTTACGTGTTCACGCAAAGCCATCAGCCAGGAAGTTGTAGTTAllele specificAB032898
21Fgfr215AAGGACAAACCCAAGGAGGCTGCTTTGTTCGTCTGAGACACGAGCAATGin/delD13551
22Fgfr322TAAGGAGAAGCCCAATAAGCCACTGCTGCTCATCTGGAATTTTGCAGGTGAvaIID13552
23Fgfr414CAAGGACGGCCCGGAGCAGGCCACCCTGTTCCTCTGGCACTTTGGTCACAHinfID13553
24Green5CTTCTTTTCAAAGAGCTCAGCCCACAGGCTATCATAGTCGAGGCTGin/delAB001603
25Hoxa10a11CCTCTTCAACATGTACCTGACCCGAGTTGGACCCCACAGTGGAAATGAGTCATATTAllele specificAB026974
26Hoxala11CCATTTCAACAAGTACCTGACTCGGGCTGCACACGATTGACCCGTAAACGTCTCPsp1406 IAB026948
27Hoxa3a11GTACGCCATGCCAACGTCATATCCACAAGGTGGGAGCCTTGAGGAGGCGCAAllele specificAB026951
28Hoxa4a11CCACTTTAACCGGTATCTGACCCGCACAAGAGTGTAAAATACTGAAGATCGGTCCATCAllele specificAB026954
29Hoxa5a11CCACTTTAACCGGTATCTGACCCGCACAAGAGTGTAAAATACTGAAGATCGGTCCATCAllele specificAB026961
30Hoxa9a11GCATCACCAAGAGAGAAGGACGAGCTGCACTCGCGTGGAGCCAGTTGGAAACHinP1 IAB026972
31Hoxa9b16CTTTTGTGAATATCCCGTGCGAGTCCTCTGGTGGGCTTCGCTTGCAGCCAACAllele specificAB026971
32Hoxb1b19CCACTTCAACAAGTACCTGACCCGCGTGCAAACAATGACACCAACTCAAATCACAGCHaeIIIAB026947
33Hoxb4a8TCACTACAACAGATACCTGACGCGCAGGCACGGACGTGAGAAGGAATCGCTTCGATCCMspIAB026956
34Hoxb5a8CCACTTCAATCGCTACCTGACCAGGACAATGGCATGCTGAAAAGTGCTGCGCAllele specificAB026959
35Hoxb5b19CCTTGGATGCGGAAACTGCACATAAGCAGCGTCTGGTAGCGGGTGTACGCAGDdeIAB026962
36Hoxb6b19CCACTTCAATCGCTACCTGACCAGGACAATGGCATGCTGAAAAGTGCTGCGCAllele specificAB026964
37Hoxb9a8GAGTAAGGAGGGATGTGAAGGCAGCCGCGCGTGCAGCCAGTTGGCTGAAGXbaIAB026969
38Hoxc10a7CTTGTTCAACATGTATCTGTCTCGGGAGCACAACGATAGTGCCGCACTGTGCAGHinP1 IAB026973
39Hoxc3a7CCACTTCAGCCCTTACCTTTGTCGACCAACAATGATATGAAAAACCTGCTGGATGDraIAB026953
40Hoxc4a7TCACTTCAACCGGTACCTGAGCCGCCTTAAAGGAAACCGCACAAGATAGCTACGAllele specificAB026955
41Hoxc5a7TCACTTCAACCGGTACCTGAGCCGCCTTAAAGGAAACCGCACAAGATAGCTACGAllele specificAB026960
42Hoxc9a7TCCAGAGTCGGAGCTGCTGACTTCGCGTCGAACGAGCATGTATCCAATTTGCCHindIIIAB026970
43Hoxd3a21CTGACGCATTTGTAATATATGGTTCCGGAAAAGAGCGCAACATAATTTTGGCACin/delAB026952
44Hoxd4b15CCACTTCAGCCGCTACCTCACGCGCTCTTACAGTGAGAGTTACAGCTTTCCCBbvIAB026957
45Hoxd9a21GCAGCGCAGAGCAAGCGAGATTTCGGAGCGCGCGTGGATCCAGTTTGCAGMboIIAB026967
46Hoxd9b15CCTCTACAACATGTACTTGACCCGGCCGGCTTTGAAACATGCAGGAGGACGAGN1aIIIAB026968
47Hsc7014ATGCCAGAGGGAATGCCAGGAGTTCAGCATTTATTGTAGAGTGACATCDraID13669
48Ki-ras6ATGACGGAATATAAGCTGGTGGTGGAGGAAGCCCTCCGCTGTCCTin/delAF030545
49LMP211GGCTCTGATTCCAGAGTGTCTGCACAGAGTGGCAGCTGAGCGAACCTBglIID89724
50LMP711CTGTAYGRCTGAGAAACAATCCTTGTCCCATCCACAGATPvuIID89725
51mfOR2ATGTTGATACTGTCCTGGCTTTGGAATAATCTCAGTGGTTGGTGTCCTTTaqIAB022647
52mfOR314CTGAAATGACCCCACCCTTGCATGCAGAGGAAACATGATAGCin/delAB022648
53mfOR414TCAGAGGCATCCAAGTATCCAGGTACTCAGGGAAACGATGTAGCMnlIAB022649
54Msx1015AGACCAAGTGCGAGTCACCGAACGGATGGAGAGGTACTGTTTCTGACGIn/delAB033287
55Msx414ACCGAAGGAAGACTTGATGGCAGTGCATGGACAGGTACTGCTTCTGCCMnlIAB028880
56Olgcl12GGCCGAGCCGTGACTTTATTTGTTCTAGGAGGGTGCTTTGCTCCACAGTTACACAAin/delAB004921
57Olgc216CAGCAGAGGGTCGTAAGAGGCGTCTTTATTTATTCACTCCTTCAGin/delAB016082
58Olgc32CTCTTGCTGATTTCTGAACTCAGCGTCACTTCGTAACHinfIAB000899
59Olgc413CAACGGTGCTAATGTAATGAAAGTCTCAGACATATTGGGGGAAAGTAAFokIAB000900
60Olgc514CTCAGCAGTGCCACAATAAACAATGACTCCGAACATAAATCGCTGGAGACTGACATGGGAin/delAB000901
61Pax63CCCTGTAACCACCCACTCCACCATCAACACCGGGCACTTTACAGAAGGTCCAin/delAB002408
62Phr17GAYAAYTTYTGCTTCTACAACCATGGANGCCYCAGATNGACCACATin/delD26022
63Red5TGGAGTGCAGTCCTACATGATTGCTGTCTTTGATGTAGAAACTTCAGN1aIIIAB001604
64Rhodopsin7AAACACCACCGAGGGGCTGATAGATCCAGGTGAAGACCAAACCCATEheIAB001606
65Shh20ACCACTTCGAGGAGTCCCTTCACTGTTCCCTCTCCCTTCTTGATGARsaIAB007129
66Six319ACCCCGACTCAAGTAGGGAACTGCCAGCATGATATGGGATAGATCCAGN1aIIIAJ000937
67Tap 211AAATTCTTCTGGACGGGAATCCATCACCACAAGAGTCTGGTTTGGGin/delAB033382
68Tp5318AGGTGTCCCCACCACCAAACAGTGAGGATGGTGAGGATGGGin/delU57306
69Trpl18ATGCCTTCCTTAATGATGTGTTGACCCGCACGGGTCGTCAACGMnlIAF072305
70Tyr13TACTACGTGTCCAGAGACACCTTCAGTGGACCTTCTGCAGTAGCGTTACDraIAB010101
71UAA11TCCATCAGTGTCTCTCCTCCAGAAGGCAGACACAGAGAGAATGACAGCGin/delAB026977
72UBA11TCCATCAGTGTCTCTCCTCCAGAAGGCAGACACAGAGAGAATGACAGCGin/delAB026978
73UCA22TATTTTTGTTGCTGTCATTGAGCCTAAATCACAAAAGGGGTTTAllele specificAB033381
74Violet23GAACTTTGTCGTTCTTCTGGCGAACTTCCTTCTCAGCCTTCTGCGTBssSIAB001605
75Yc-11GAGGTAATAGTTGGCAAAGGAGCTACTGAGCTCAACCAGAGGACASau3A1AB033606
76Yc-21AAGCTGCGCACCTTCTATGAGAAGCACTTGCGCTTGCGCTCACCAGTRsaIAB033607
77NK-18ATGACGGAATATAAGCTGGTGGTGGAGGAAGCCCTCCGCTGTCCTin/dela
78FS-119GAATTCAAGCCAAAGATGTTAACTGAAACAAAATGAAGGAllele specificAB033330
79OPH3-112ACTCTGTCAGTCTGGATCTGATGCTGATAACATGAGGTGCAllele specificAB033329
80Can37GAAACTAGTGCTGACAAGCAAGGCGAGCTGTGGAAGTCCCTCCATTTin/delAB033286
  • Act-c, cytosolic β actin; Act-m, muscle actin; B2m β2-microglobulin; Bf/C2, complement factor B/C2; Blue, blue visual pigment; C3-1 and C3-2, complement C3; C4, complement C4; Casp3A and Casp3B, caspase 3; DAB, MHC class II B; Ef-1A, elongation factor lα; Eya, eyes absent; Fgfr, fibroblast growth factor receptor; Green, green visual pigment; Hox, homeobox gene; Hsc70, 70-kD heat-shock protein cognate; Ki-ras, ki-ras proto-oncogene, LMP, low-molecular-weight polypeptide; mfOR, olfactory receptor; Msx, msh/msx class homeobox; Olgc, guanylyl cyclase; Pax6, paired box homeotic gene; Phr, photolyase; Red, red visual pigment; Rhodopsin, rhodopsine; Shh, sonic hedgehog; Six3, sine oculis related gene 3; Tap, transport associated protein; Tp53, tumor suppressor protein p53; Trpl, tryrosinase related protein 1; Tyr, tyrosinase; UAA, UBA, and UCA, MHC class I A; Violet, violet visual pigment. Yc-land Yc-2 are the expressed sequence tagged site markers located on the sex chromosome.

  • a NK-1 is a marker that is amplified under low annealing temperature (55°) but not amplified under high annealing temperature (60°) using primers for Ki-ras. FS-1 and OPH3-1 are anonymous sequence tagged site markers. Can3 is a simple sequence repeat (CA repeat) marker.