TABLE 3

List of mde genes

FLEX-like elements
Gene nameaPositionbDirectioncSequencedPredicted gene product
spo6 (SPBC1778.04)−73−99AAATATTTGAEmbedded Image AACAAAATCADbf4-related protein
mde1 (SPAC16E8.05c)−158−184AATGACCAATGTAAACAAACAAAATCG
mde2 (SPBC31F10.08)−78−104GGTATGGAATGTAAACAAACAAACTCA
mde3 (SPBC8D2.18c)−60−86ATGTTGGAATGTAAACAAACATAAACAIme2-related protein
mde4 (SPBC6B1.04)−253−279TTCAAGATACGTAAACAAACAAAATTC
mde5 (SPAC4A8.01)−66−92TTACTTCATTGTAAACAAACAAAAATAα-Amylase precursor
mde6 (SPAC15A10.10)−79−105AGCACCTAATGTAAACAAACAAAAGAG
mde7 (SPCC320.07c)−282−308TTTTATCGAGGTAAACAAACAAAAAAARNA-binding protein
mde8 (SPBC19F8.01c)−26−52TTATTAAGCAGTAAACAAACAAACCCASeptin-related protein
mde9/spn5 (SPAC24C9.15c)−251−277TGCGAGTCATGTAAACAAACAAACATTSeptin-related protein
  • a The name of ORF assigned by the genome sequence project is given in parentheses.

  • b Numbered with the translational start point at +1.

  • c Arrows indicate the direction of FLEX on the coding strand of the respective ORF.

  • d Completely conserved nucleotides are shown in italic type. Dots represent a core heptamer.