TABLE 1

Primers used in the survey of four-cutter variation in the ASC

NamePrimer sequenceAnnealSize (bp)Post-PCR
MC5-FCCAATTGTTAAGATTATATGATGC56233
MC5-RTTAAGATATCCTTGAAGAGCGTG
MC7-FTAGGACTGAAAGAGCACATGTC56346Sau3A
MC7-RATTTCGACCGATTTCCGCTCCAG
MC12-FGGAGTGGAGGTGCCAAAGGCC56382HaeIII
MC12-RTTGCGTAAACTCTTAACCTTC
MC18-FTTCCTTACCTGTGCAGGCAGC58225DdeIa
MC18-RTTTCCGGATAACGATCAACAG
MC21/22-FAGGGGATCCATCTATTGCATCAGG56480DdeIb
MC21/22-RGATCGGGTTAAAACTACCTCAC
MC33-FTGGTGGGAGGCACATGCACC61241
MC33-RGCGAAGTTATCCTCCTTTCTCGGC
MC40-FGATGAATTCATGGTGTGTTTTCGGTGTCGC56c4 kbHaeIII
MC40-RCCGCGAAAACCCGCGATAAACTGCTACCG
  • Primer names are designated MC followed by a number: the MC refers to Martin-Campos et al. (1992) and the number corresponds to the polymorphism numbers of Table 3 of that article. PCR reactions were as follows: ~20 ng of genomic DNA, 50 mM KCl, 10 mM Tris (pH 8.8), 1.5 mM MgCl2, 0.1% Triton X-100, 50 μm each dNTP, 0.5 μm each primer, 1 unit of Taq polymerase in a 25-μl reaction volume. PCR reactions were initially denatured for 1 min at 92° and then cycled 35 times (45 sec at 92°, 45 sec at correct anneal temperature, and 1 min at 72°). When specified, restriction digests were carried out without any purification of the PCR products and polymorphisms were scored on ethidium bromide-stained “Synergels” as described in the text, with the exceptions listed below.

  • a A 4-bp deletion scored in a 79-bp DdeI fragment on a denaturing polyacrylamide gel.

  • b MC22 is a 6-bp insertion in the 232-bp DdeI fragment and MC21 is a 12-bp insertion in the 248-bp DdeI fragment.

  • c This PCR fragment was amplified using Long PCR and the conditions described in Long et al. (1998).