TABLE 1

Summary of markers

GeneCytological positionGenetic positionPCR annealing (degrees)aPCR primersASO wash (degrees)bASO probesc
ewg1A80.060ATAACAGCAACCAGCGGCGG GGGCATCCATCCTCACATTGG50S: TGGGTATACCATCGA M: TCGATGGCATACCCA
w3C23.6
RpS67C14.263CGGTCTTTTTCAACCCTGC GTAGCCCTTCCACTCGTCAC55S: GAATTGCAGCGGATA M: TATCCGCAGCAATTC
v10A23.455TGTCCCTATGCAGGAAACGG TGAACAGATGCTCATCGTGC43S: CGAGCAGCTTGTCCA M: TGGACAAACTGCTGG
Sd13F40.655ACGGCGTTCATGGAAATCCAG GGGGAGCGTTGAATGCGATAGRTS: AACTACACACATATA M: TTTATGTATGGTTAG
run19E59.355AGTGCATACCGAGAATCCGC ATTGATGGCGATTGCGGAGG55S: CGACGGTCGCCGGTT M: AACCGGCAACCGTCG
g121A–B0.060/55TATCAGCAGCTCTATTGGCG AAGCACACCTTTTCGATTCC37S: AATTGCCAAAAGTAA M: TTATTTTCGGCAATT
Pgk22D–23C7.057GGCAAGCGGGTGTTGATGCG TTGGCAGGATCGGCCTTGAC53S: CCGCTGAACTGAAGA M: TCTTCAGCTCAGCGG
Cg25C25C17.055GATAGAGGTGCCCGACTGTC CTGTGTTGGGATTGGAGGTC42S: TTAGATTACGGAAGA M: TCTTCCATAATCTAA
Gpdh26A22.060/55CCCCTGTTCACGGCTATTC CTGGTGATTTGATCTATGCGG40S: TGTTTACCCTGCTAT M: ATAGTAGGATAAACA
ninaC28A28.555GAAGTCCATCTTCCAGGTCC TATGGGCACTGGCAGTGGTCRTS: TATGTACCAGGTCCA M: TGCACCTTGTACATA
G1t29D34.760/55ACCCAGCCTCACTAGCCAC TGCCCACTGCTTCCAGAG53S: TAACATCGACGTTGC M: GCAACATTGACGTTA
prd33C1-255.255GATGCAAGGTGAGTGTCTATCG GCCATGGGATACACGTAGCT
Mhc36A68.060/55TCATTGGTGTACTGGATATTGC CCTCCTTCTTGTATTCCTCTTG52S: ACCAAACCACACAAA M: TTTGTGTTGTTTGGT
DoxA237C71.955TGGCTGACGAGAAGAAGAAC CAAGATTCCGGAAGACGACG56S: CCTTCGAAGCTACCC M: GGGTAGCCTCGAAGG
DucC41-4276.460/55AAGAGGCCACAGAGCAGC TTACCCGAGAAGATGATGGC40S: ACTCACACGGAATCT M: AGATTCCTCGTGAGT
eve46C83.960TTGTGGACCTCTTGGCCACC AACTCCTTCTCCAAGCGACC
s1i52D113.950TTACCAGCTTTAAGGGCTGC CATTTGTTCTCCAGGCAAGG45S: TTTAGCTAAAGCCCT M: AGGGCTTAAGCTAAA
p1u56F130.860AGCTGCGTTGGACAGGAC CGCACATTGCGCTTATCTAA51S: ATGATGTCGTTTCCC M: GGGAAACTACATCAT
Egfr57F135.160/55CGTAAGCAATATCCGTTGGC CACATGGACGCACTCCTG40S: TCAAGATAGGTGGGA M: TCTCACCCATCTTGA
twi59C138.855TCCCTGCAGCAGATCATCCC ATCACTCGAGCTGAGCATGC37S: TCTACCATTTAATGC M: GCCTTTAATTATAAT
zip60F145.960/55TGTGAGTGTGTGTGGGTGC GATATTCGCTTTTCGGATGC56S: ACACTATCAGAGCCC M: GGGCTCTAATAGTGT
Lspl61A10.055GAATGACGAGGGCATCCGAAG TGACCAGGGCTCCGAAAAACTC40S: AACTCCACTTTCTTA M: TAAGAAAATGGAGTT
ve62A5.053GAGAACCCAACGCAGAATGT ATATCCTCCGACTCCGGAAG56S: TGCTGCAATCGGTGT M: ACACCGACTGCAGCA
Acr64B64B-C14.363TGGGATGAGGCCGACTAC GTGGGGTGGTTGCTATCG45S: CCATATTAATATCTC M: GAGATATCAATATGG
Dbi65E21.360/55ACCCAGAATGGTTTCCGAG GCAGGAACTCGTCATCACTG37S: GAATAGTTAGTTCGC M: GCGAACAACTATTTT
h66D28.755ACTCAAGACTCTGATTCTGG TGTCTTCTCCAGAATGTCGG41S: TCTACTTCCAGCCGG M:CCGGCTAAAAGTAGA
CycA68E43.260/55ATTTCGCCGTGCTCAATG ACGTCATGGTTCTCTTTGTCG37S: AGAAGTAAGTAAGTG M: CACTTCTCCATCTTA
fz70D50.055GTTGCAGGTGCTCACCTTC CGCCATGCAACAGAAGTAG51S: ATCCAACAACCAAGT M: ACTTGGTAGTTGGAT
Eip71CD71C–D53.555CCTGTATGGAGCCACCCG GGGGCTGAGATTTAGCGATG45S: AATTTCCCCGTTTGC M: GCAAACGTGGAAATT
tra73A59.956GAACAAGCGAGAGGGATAGC CTTTGGCGGTGGATTATACC56S: TTCGAGAACAGGATC M: GATCCTGCTCTCGAA
rdgC77B71.763CAAAGACATCGACTCAGCTACG CGAACTCTCCACGATGCC51S: CACCACCTTTCACCA M: TGGTGAACGGTGGTG
5-HT282C76.360/55TGACGATTCCCCTCCTCC CGCCCACTGATAGGAATTTG48S: AATGGCATACTCGTT M: AACGAGTCTGCCATT
Antp84B83.260ACGGACGTTGGAGTTCCCGA ACATGCCCATGTTGTGATGGRTS: CACCTACTTCAACTT M:AAGTTAAAGTAAGTG
ninaE92B89.555CTACATCTGGTTCATGTCGAGC CCACAGCGTGATGGTGAC51S: CTGTAAGCGGCGACG M: CGTCGCCACTTACAG
Fasl89101.360/55GCGACTCTTTGAGTATCCGC GGCCAAGATGATGCAAATG41S: ATGTGGTATACTTAC M: GTAAGTACACCACAT
Mst87F114.250TCCTTTGCCTCTTCAGTCCG TCCACAGGCATAGCATGGTC37S: TTCTCCCGTCGAACC M: GGTTCGCCGGGAGAA
Odh86D123.355CAGTGGTGTTGGGACATGAG TGGCCAGCTCAAACTTGTC51S: TGAAATGAGGCGTTT M: AAACGCCACATTTCA
Tub85E85E126.660/55ACCAGTGCTAGGATTTTCGTG TCCAGTCTCGCTGAAGAAGG37S: TGGATCCCTGAAAGT M: ACTTTTAAGGATCCA
hb85A3–B1134.653TCTGCCCATCTAATCCCTTG CTGCGTCGAGTTTTTTCCTC37S: CCCTGGCTTATTTTT M: AAAAATACCCCAGGG
Rox895D147.760/55ACAACAGCTCTGACCGCC GACTTCCCTTTACACCGGAC37S: GTTATCATATGGCCA M: TGGCCACCTGATAAC
A1d97A–B157.755ATGGGCCCTCACCTTCTC GTGGTCATCCACATGCAAAG37S: ACCAATCGTGCATAG M: GTATGCACAATTGGT
M1cl98B161.463ACCCTGTTCGCTGACTGC AAGTAGACATCCAGAGATCGGC42S: GTGCATAAACGATTT M: AAATCGTATATGCAC
jan97A–B171.255CGCATTGAACACAATCCCGA CTCATCGGAGATTTCGATCG37S: TTCCAAAACCCTTAA M: TTAAGGGCTTTGGAA
Ef1d2100E174.655GACTGGTCTCCTCAAGCCAG AGCCTCGTGGTGCATCTC37S: CCAATTCAGCAGAAT M: ATTCTGCAGAATTGG
  • a All PCR reactions followed this format: 94° for 3 min, 1 cycle; 94° for 45 sec, annealing temperature for 30 sec, and 72° for 15 sec, 40 cycles, unless two annealing temperatures are given; then the first was used for 10 cycles and the second for 30 cycles.

  • b Done for 15 min at designated temperatures.

  • c S, simuians-specific probe; M, mauritiana-specific probe.