TABLE 7

RGH-specific primer pairs

Primer designationPrimer sequences (5′ → 3′)Fragment size (bp)RGH designationRegion of RGH ORFAnnealing temperature
39F236TCCAATTCCGCAAGCTCTGAG571RGHlaP-loop56
39B318ACCTCTCCTACAACATGGAGGATG
39F146AGCAGATACCTCGCCTAGACCATC334RGHlaMiddle56
39B184GGTAAAGCCAAAGAGTGAATGGG
39F13GGTTACCATCCTCTTTCGTCACC582RGHlaLRR56
39B95GGAGGCTCGTTGTGTCTCTGAATAC
15B02F1TTTCCCAACCCACCAAATCC307RGHlbP-loop58
15B02B9TCGGCGTGTTCAAGAAAGGC
15G06F34CGAGCAAAAACAGGCTAGTCCC527RGHldMiddle56
15G06B21CAACAGGAACAATTTAGGCAGTCG
38F13GCTTGAGATCATGCACACTGTCC467RGHleP-loop52
38B58TGTTAGAGGCATCGTCTTCGGTC
38F19TGGTTCCAACTGGTGTGTTGC426RGHleLRR54
38B27CCCCAATGATTTCCACGTCC
15A08F2AACATGGAGATGATGGAGGCG750RGH2a5′60
15A08B3TTGCGAGAGTATGCTGGTGAGG
FWA57FACCCTCGCCAGACAAGTTTACC165RGH2aP-loop56
FWA55BGAAAAGCAGCTTATGCACGTCG
38IF2CAGACATGCTGTGCAGATACCTCC420RGH2aMiddle54
38IB4TTCGGCTATCCACTGCTTCACC
FWA61FCCTTTTCTGGATTGCTCAAGTGC277RGH2aLRR56
FWA59BATCTGGGTTGGAAGCTCCACACTC
FWA62FCTTTGCACTCTGGGCATAATTGAC341RGH2aLRR56
FWA63BAAGCTGGACAAGATGAAGCAGC
FWA53FTCGGCATCCTTATGATCCAGC202RGH3aP-loop56
FWA51BTGCTCGACATCGAACCAAACC
80H14R1F3CGTGATTCCCAAGGAAATTGC500RGH3aMiddle56
80H14R1B6GTTGCCATGTAGCTTGAGTGAGC
80H14R1F30TGCTTTACCTCAAGTTGGCTGC212RGH3aLRR56
80H14R1B35CGAAGGTGTGTGATTTCGATGC