TABLE 6

PCR primers derived from Morex BAC-end sequences and amplification on parental barley lines

PCR amplification on mapping parentsbPCR amplification on mapping parentsb
BAC clonesPrimers for R1 end (5′-3′)Fragment size (bp)Annealing temp.Sequence originaCI 16151CI 16155Primers for T7 end (5′-3′)Fragment size (bp)Sequence originaAnnealing temp.C.I. 16151C.I. 16155
80 H14TGCTTTACCTCAAG21254C.I. 15773++GGTTACATTAGAG422C.I. 1577354++
TTGGCTGCCACTTGCACCC
CGAAGGTGTGTGACCAAGGACGAGGA
TTTCGATGCAATCAGTAGG
GGTGTGTGATTTC14654C.I. 16151+
GATGCC
CAGGAGCCTGCAC
CGTCT
GGTGTGTGATTTC18954C.I. 16155+
GATGCC
TGCCAACTGTGTC
GACGT
401 K4CAGAAGTGTTCAC19251C.I. 15773++NANANANANANA
TCATCCCCG
AGATATAGCTTTC
CATCGCACAATG
711 N16GGAATGCAATGTA31053C.I. 15773++NANANANANANA
andAGGCTTAAACAC
709 G18cGCAATCACCAGGG
TACTGATATGC
721 K19TTCAATAATCCCCT25556C.I. 15773+GGTAGTAATCAAG457C.I. 1577353++
CAGTCGTAGCCCAATTCCGC
AACGGTTGCCACGCAATCACCAGGG
CATCACTGTACTGATATGC
257 G8AATTCGTGAAGGG44756C.I. 15773++TTCAATAATCCCCT255C.I. 1577356+
TTTCGTGGCAGTCGTAGC
GGATATTCCTCAAACGGTTGCCAC
GATCGGACAAGCCATCACTG
175 D16CTGACCAAAGTGA32753C.I. 15773++CACCAAAAACTTT445C.I. 1577350++
TCCTTAGCTCAGTACCCTC
CGATAGCCATTGTATACCGTGACCTC
GGAGTTGGAGTCTGCTC
TGTTTAATAATTT272C.I. 1615151+
CAACACAAAG
ATACCGTGACCTC
TCTGCTC
540 G23 and 555 A13CCATTTCAACAATCCAGTGTGCTCACGCAAAAAACGT38670C.I. 15773CCGATGAGGGAAGCAATCTGACAGAGCAAAAGCAG329C.I. 1577356++
and 559 A6cGGGTGCCAAAAGGC
206 D11 and 206 120cNANANANANANACTGGTTTGTTGTTGCTATGCGTTGTCATTTGGTGTGGGGCAAAG470C.I. 1577356++
TTTTGATCTGATCCGGCGC298C.I. 1615556+
TCATTTGGTGTGGGGCAAAG
  • NA, data not available.

  • a Accessions C.I. 16151 and C.I. 16155 contain the Mla6 and Mla13 specificities, respectively. C.I. 15773 is the designation for Morex.

  • b +, amplification; −, lack of amplification.

  • c BACs of identical size and inserts.