TABLE 4

YAC clones isolated from the Maltagen Franka library

Clone designationaIdentified bycInsert size (kb)Primers for right endb (5′-3′)Primers for left endb (5-3′)Annealing temperature
75FW108.2200AGGGCACTCTCAGGGCACTGGTCCGGATGTTCCTTGTGGTAACAC56
101Frl062, FW108.250
105FW108.230GGATCGGCGAATTCCGTATGGAATTCAAACAGATTCATAA56
152FW108.230/200
234FW108.250TGATGTCGCGATGTTGCTCGGAATTCTGCTTGAAACCATT56
236Frl062, FW108.2280/600CTCCTCACATCGGCTAGCTAGATAAACCAATTAAGAGGCAGTGCATGAATTCTGCAGCGTTGTCCATTCCTGGCATGATCGCCTGGGCCAT56
98IIF5mwg2197, 236R160
99IIE7mwg2197, 236R160
120ID1mwg2197, 236R170
  • a YAC clones were identified by PCR amplification with M1a region markers.

  • b Primers used to amplify the ends of the designated YAC.

  • c RFLP, RAPD, and AFLP markers used to identify various YACs.