TABLE 1

PCR and sequencing primer sequences

PrimerPositionSequence
LOG42163, upstream of exon 15′ TCAGACTAAATCGAAAATC 3′
SHA22182, upstream of exon 15′ AAATCGTACTCTGACTACGGG 3′
PWR.302953, upstream of exon 35′ AGTTCACCGTGACAGCGTCTCTTC 3′
PCR23162, downstream of exon 35′ TTCGCTACGAGATATTTGCGCG 3′
PWR.403803, in intron 35′ GAAATGGGATCTCGGTCGATG 3′
PCR34225, upstream of exon 45′ GCGAAATTAAAATGTGCGAAACGTC 3′
PCR114397, in exon 45′ CATATTCCATGAAGAGGA 3′
PCR44700, downstream of exon 45′ ATTTAACACAAATTGTCGTGTCGAGA 3′
PCR55502, upstream of exon 55′ ATTTCCCAGCCTTGTTCCTAAT 3′
PCR135690, in exon 55′ TCTCAACGCGGCAAATGC 3′
6506606, downstream of exon 75′ GGTGACGCGCGGCAGGCTT 3′
BD16885, upstream of exon 85′ GTTGTCCACGAGTATTACACGG 3′
12007123, downstream of exon 85′ GGGCGAAAGAGAACTGGGGG 3′
PCR67128, downstream of exon 85′ ACTAATTGGGCGAAAGAGAACT 3′
PWR.3219.6 kb downstream of PWR.405′ CGCGGCGACTTGCTGATTGTGGG 3′
  • Primer positions are based on the ced-3 genomic DNA sequence as published by Yuan et al. (1993) and indicate the position of the 5′ end of each primer.