TABLE 1

Pinus sylvestris chloroplast simple sequence repeat primers

LocusRepeatLocationPrimersSize
PCP1289(T)17psbA/ORF22 intergenic
region
TCCTGGTTCCAGAAATGGAG
TAATTTGGTTCCAGAATTGCG
113
PCP9434(A)10ORF59a within trnG
intron
AAACTGACGTAGATGCCATGG
GCGGTATGAGGGAAGAAGC
131
PCP26106(A)14rpoB/ORF46a intergenic
region
AATCCGACAAAAAAGATTCGG
GCTCCATTTCACGTGGTTG
149
PCP30277(A)12(G)10ORF46bTGTTGATGTCGTAGCGGAAG
ATGAAATGAATCACTTCCCCC
138
PCP36567(T)11psbJ/ORF42b intergenic
region
AAAAGAGGAGGAAAAACACCTT
AAGAGCAGACAAGTAAGGGGC
115
PCP41131(T)11ORF119AAAGCATTTCCAGTTGGGG
GGTCAGGATTCATGTTCTTCC
138
PCP45071(T)15ORF46d/atpB intergenic
region
ACTGGTCTGATCGACCCAAT
TTCTACACTTGCGGAAACCC
149
PCP48256(T)10ORF64aACGTTGGACCAGAGCAGG
CGAATTTTTCGAAGAACTAGCG
120
PCP51928(T)10trnS/ORF57b intergenic
region
CTTTCTACGGAACGGAAAAGG
GCACTGCGGGAAAAAAATAA
141
PCP63771(T)10rps19/rpl2 intergenic
region
TGAACGTGCCATGATCAATT
GGGGCTATAGTGCACTTGGAA
140
PCP71987(T)16IRF169 intron 1TCTTTGCAAGAAGGATGGCT
GGGGAGTAATCCGTGGAATT
113
PCP79987(A)12trnS/ORF49b intergenic
region
TTTTCAACAATTGCATTTACCG
GGCGGGATAGGAGTCTTTTC
120
PCP87314(T)14trnI/trnA intergenic
region
TCCAGGATAGCCCAGCTG
TATATCCCCCGTACTTGGACC
116
PCP100842(A)12ORF1756/ORF64c intergenic
region
TCAATACAAATGATGGGAGTCG
TTTTGCCATATCCTGAAACTCC
146
PCP102652(T)11jndhI/ORF43d intergenic
region
TTCCCAGATCCATTGAAATACA
TATGTGCGCGATAATTTCCA
117
PCP107165(A)10ORF44d/ORF40f intergenic
region
GTTTTGGATCGGAATGGATG
CTATCCATTCTGCCTTCCCA
148
PCP109612(A)11ORF49c/rps12 intergenic
region
ATCGAACAACGAGAATAATCCA
TTGGGGGTGATAGTGGAAAA
150