TABLE 1
Comparison of selected D. melanogaster cis-acting sequences to the DgYp1-DgYp2 intergenic region of D. grimshawi
| Element | Sequence and locationa | |||
|---|---|---|---|---|
| DSX-B | ||||
| D. melanogaster | -284 |  | -255 | |
| D. grimshawi | -198 | GAtgCacCAAAGgGcaTgCAAcTatAtAat | -168 | |
| DSX-C | ||||
| D. melanogaster | -240 |  | -223 | |
| D. grimshawi (Yp2) | -444 | GaaGCTGCTAAcagtatt | -427 | (opposite strand) |
| DSX-A | ||||
| D. melanogaster | -308 |  | -289 | |
| D. grimshawi | -269 | tacACTACAATGTaattga | -287 | (opposite strand) |
| AEF-1-C/EBP | ||||
| D. melanogaster | -312 | GTGCACAACTACAATGTTGCA | -291 | |
| D. grimshawi | -265 | GaattacACTACAATGTaatt | -285 | (opposite strand) |
| D. planitibia | -268 | GacttagACTACAATGTaatt | -288 | (opposite strand) |
| BBF-2 | ||||
| D. melanogaster | -234 | GCTAAGTCATC | -224 | |
| D. grimshawi (Yp2) | -438 | GCTAAcagtat | -428 | |
| D. grimshawi (Yp2) | -272 | tgTAAtTCtat | -262 |
-
↵a Locations are with respect to the Yp1 transcription start site except where noted. DSX-A, DSX-B, and DSX-C are DNA elements that bind the DSX transcription factor (Burtis et al. 1991) and the consensus regions are shown with a line above them. Other transcription factor binding sequences are from the following: AEF-1-C/EBP (Falb and Maniatis 1992) and BBF-2 (Abel et al. 1992).