TABLE 2

Oligonucleotide primers for PCR

Sequences
Tn903-1GGCAAAGTCGACAAAAACAATAGGCATATATAAAGCAGAGAGCACAGCAGTAC
ACACATTTGCAGTATGAGCCATATTCAACGGGAAA
Tn903-2AAAGGATCCAAGCCGCCGTCCCGTCAAGTCAG
URA3PSTAAAGCTTACTGCAGAACAAATATTCTGTCTATC
URA3-940AAGGATCCTAAAACTAATATAATGGC
HIS3PST1AAAACTGCAGTAGAACACAGCCCACAGCTACC
HIS3PST2AAAACTGCAGCCTTTGCTCGATGCTTCTCTT
TARGET 15-1CGGGATCCTGAGCTTCCAGCAGTCTCCC
TARGET 15-2CGGAATTCACGTTACCCGGATAGAAGTG
TARGET 16-1CGGGATCCAAACTGCTGTGGAGGAATAG
TARGET 16-2CGGAATTCTGTCTTCCTTTCATCAGTGACT
TARGET 17-1CGGAATTCTAAACTATCTGGTTAGTAAATTG
TARGET 17-2CGGGATCCGGGTAGACATGTTTATATAGT
ATn903 100GGAATTCGGGCAATCAGGTGCGACAATC
ATn903 500GGGATCCAAAATCACTCGCATCAACC
BTn903 200GGAATTCGATGGTCAGACTAAACT
BTn903 400GGGATCCTCGAATGCAACCGGCGCAGGA
CTn903 360AAGGATCCTATTTTATCCTGAATCAGGATA
DTn903 280AAGAATTCATGGTTACTCACCACTGCGA
DTn903 330AAGGATCCTAATACCTGGAATGCTGTTTTC
ETn903 450GGAATTCTCAGGCGCAATCACGAATGAAT
ETn903 650GGGATCCATCAATACAACCTATTAATTTCC
FTn903 500GCGAATTCATGACGAGCGTAATGGCT
FTn903 600GCGGATCCGGTTATCAAGTGAGAAATC
GTn903 520GCGAATTCTGAACAAGTCTGGAAAG
GTn903 575GCGGATCCGAATCCGGTGAGAATGGCA