TABLE 1

Primers for PCR amplification of microsatellite markers

MarkerLocusLocationSequencesaType
1.1Notch3CtttgcggcttcgtttgtttaGT
gatccgcccacatacacact
1.2tenA11ActcttagtgcgcagggattcAT
gagtcgctcaatggcagg
2.1pendulin22DacgtttcgagctcatttcggAAC
acactggtgtgaagggaatg
2.2ninaC28ActcgcttccaggactttgtcAT
gcatattgatcctctcgaag
2.3Sos34DcgagcactgcttgagtgcagAT
gtctgtctgtctgttctacc
2.4DHR346FcttttgcttcgtagagaaccgAC
tgcggtgtagagaatttcgc
2.6Amy54AacgggaacgccatctaacGT
agaagagaccctgcaacaca
2.7Distal-less60EgagcactggcaagttaggcgAC
ccttgcttctgtgattgagg
3.1trh61CagtacttcgctccgcattcgACC
cctggcttgcactggatc
3.2z60071CaaatctgttgctcatactgcccTTC
aaccggcgaaatgttcag
3.3E74B74FgcatgcaaatgcgcatgtggAC
ggcaaacaaacgtaatcgcg
3.4Antp84AagatccgagatgcgagatgcCT
tgtgcgtgtagattgtcaag
  • a Sequences are written in the 5′-3′ direction for the forward (top) and reverse (bottom) primers used to amplify ̃200-bp fragments of each locus. tenA and z600 were obtained from Goldstein and Clark (1995), Notch and Amy from Schlotterer et al. (1997), and the remainder were designed in our lab.