TABLE 2

PCR amplification of 5′ and 3′ actin gene-specific probes

GeneUTRSense oligoPrimer sequence (5′-3′)Antisense oligoPrimer sequence (5′-3′)Product bp
ACT15′ACT1-5′S1TCCTCCCATTCCCTTCTCCTTCAATACT1-5′10ATTCACCATCAGCCATTTTCTTCTAC600
3′ACT1-376SagctcccgggCTGAGTTCAAAGTGATCATTTTTCAACT1-3′226AagctcccgggTTACATAATAATTGAAAAATTGAAG250
ACT25′ACT2-5′S3TAAAGTTGTAAGAGATAAACCCGCACT2-ATGAGCCTCAGCCATTTTTTATGAGCTGCAAACA680
3′ACT2-376SagctcccgggCTAAGCTCTCAAGATCAAAGGCTTAACT2-3′189AACTAAAACGCAAAACGAAAGCGGTT200
ACT35′ACT3-5′S2TCCTTTGCGAGAACGAGGACGAGACT3-5′A2GACGAAATCACAGATCG845
3′ACT3-376SagctcccgggTTGAGCTTGAAGTTAAGTCTGCTTCACT3′243AagctcccgggTATCAAATAACCTCTCTAAACTTGG250
ACT45′ACT4-5′S2CAATATTGAATAACGATTAATTAACACT4-5′2ATGAATGTCTTCACCGTCCGCCATT460
3′ACT4-376SagctcccgggCTAATCACAGTTCCTAAGATCACCAACT4-3′252AagctcccgggAATCTCTTTTGAGTAACAAATAAAT
ACT75′ACT7-5′S1ACGGCAACATAGACGCGTCGGTGAGCTACT7-5′A1TCACAGATCTCAAAGAG740
3′AC7-376SagctcccgggCTAAGTGTGTCTTGTCTTATCTGGTACT7-3′273ATGAACCAAGGACCAAATATAATATG270
ACT85′ACT8-5′S1TCCGTATGATCGAAATGATTCGTCACT8-5′A1GTATGATGTATCTATCA650
3′ACT8-376SagctcccgggCTAAACTAAAGAGACATCGTTTCCAACT8-3′249AagctcccgggGTTTTTATCCGAGTTTGAAGAGGCT250
ACT115′ACT11-5′S2CCCATTAAATTACTTTACAGAGTAAACT11-2AGAGAGGCTGAATGTCTTCACCATCT580
3′ACT11-376SagctcccgggCTAAGATTAAGCTCAAATCAAAGTGACT11-3′229AagctcccgggGCCCACTGGCCACTGGTTTCATCCT250
ACT125′ACT12-5′S1TTCTTCCGGTAAAACAGAGCCTAAAACT12-14AaccagCCTTGACCATTCCAGTCCCG540
3′ACT12-376SagctcccgggCTGATCAAAGTCACCAAGTAAAACACT12-3′223AagctcccgggAAGCAGAGACAGAGAGGAAACTCAG250
PRF13′PRF1-3′S1agctccgggACCAAGGTTTCATTTCAGGTTCTTCPRF1-3′A1AATCAAAACTCAATACATATGGAGA250
PRF43′PRF4-3′S1CTTCTTACAATGTTCCACCACCTACPRF4-3′N1tgactggatccACCAAGGCAAAGAGAGTAAAAGCCT200
  • See Table 1 for details on naming primers. Lowercase letters indicate a 5′ sequence, usually a restriction endonuclease cleavege site that is not part of the actin priming sequence.