TABLE 1

Primers and polymorphisms used in CAPS mapping

Diagnostic fragments (bp)c
GeneOligonucleotide primersaPrimer sequence (5′–3′)bPCR product (bp)EnzymeCOLA
ACT1ACT1-5′S1TCCTCCCATTCCCTTCTCCTTCAAT1600HinfI350250, 100
PLACT284AATRTCNACRTCRCAYTTCATNAT
ACT2ACT2-5′S3TAAAGTTGTAAGAGATAAACCCGC2280HaeIII800700, 100?
ACT2-3′289AagctcccgggTTAACATTGCAAAGAGTTTCAAGGT
ACT3ACT3-5′S2TCCTTTGCGAGAACGAGGACGAG1250MboI520600
PLACT1ATTNACCATNCCNGTNCCRTTRTCRCANAC
ACT4PLACT119SGARAARATGACNCARATNATGTTYGA1310DdeI175 × 2350
ACT4-3′252AagctcccgggAATCTCTTTTGAGTAACAAATAAAT
ACT7ACT7-3′S2TTGGTAAGTGAGTGGCT1450HinfI550, 300850
ACT7-3′A4TGCAGATACTTAGACGAAGATTTAC
ACT8ACT8-5′S1TCCGTATGATCGAAATGATTCGTC790BstYI225 × 2, 140345, 245
PLACT11ATTNACCATNCCNGTNCCRTTRTCRCANAC
ACT9ACT9-59SCAGAGATATTCTCACAC1500DdeI950700
ACT9-3′249AagctcccgggTCCAAATCGGCAACTGAACCACATT
ACT11PLACT119SGARAARATGACNCARATNATGTTYGA1350EarI700800
ACT11-3′229AagctcccgggGCCCACTGGCCACTGGTTTCATCCT
ACT12ACT12-5′S1TTCTTCCGGTAAAACAGAGCCTAAA550MboI250, 95550
ACT12-14AaccagccTTGACCATTCCAGTCCCG
PRF1PRF1-5′S2TATTTATTGTTACTTTGGTAAAGC1400DdeI700, 380, 3201100, 180, 12
PRF1-3′N1AATCAAAACTCAATACATATGGAGA
PRF4PRF4-3′S2GTCAATTGCATTCTGTCTACTACACTA1400AvaI1000, 4001400
PRF2-10AATGGTCATCGACGTATGATTGCCACGACAT
PFN4PFN4-5′S1ACAATGAGTAATGATGGCTAAGAAAGA1600DdeI700, 300, 220, 200, 180750, 350, 320, 200
PFN4-IN1AACTAAATCCGGAACAATGACTTGATGCA
TUB2TUB2-5′S1TTAAGGAAACTTACACAGTAGAGAAAG1800ApoI1100, 7001000, 700, 10
TUB340ATTNACRTTRTTNGGNATCCAYTCNACRAARTA
TUB4TUB4-5′S1TATTTTGAAATCCTCCGCTGTCATACAG1400HaeIII1100, 3001400
TUB7TUB7-5′S1ATGGAATCCAGCTGTCATTCACACGAA1400HinfI350520
TUB8TUB8-5′S1CACAAGTCATAACCGTTTCAAATTCTC1280ApoI1000, 2801280
TUB9TUB9-5′S1CAATAGAAGTCTAAGGACGAAAATGCA1400ApoI900, 4001400
  • a Degenerate primers that are universal for all plant actins begin with PLACT, and all other primers begin with the specific gene name. All primers are named based on their position in the actin gene sequence. For primers in the coding region the first number is the codon number based on 377 codons for a plant actin. Primers in the 5′ or 3′ flanking regions have the prefix 5′ or 3′, respectively. The letters S or A indicate if the primer is in the sense or antisense orientation, respectively.

  • b Lowercase letters indicate synthetic restriction sites added to gene sequence. Nucleotide degeneracy is designated by N (any nucleotide), R (purine), and Y (pyrimidine).

  • c Using the restriction enzyme indicated to cleave the PCR product indicated these diagnositc fragments are produced in the Columbia (CO) or Landsberg (LA) Arabidopis lines, respectively. TUB340A is a degenerate antisense β-tubulin-specific oligonucleotide used to amplify each of the tubulin gene fragments.