TABLE 1

Comparison of censerved sequence elements in the percid mtDNA control region to elements in other species

ElementSpeciesSequencePositiona
Mt5PerchYTTGCAWGCA100-129b
Ruffe and zanderTTTGCAAGTA100–129b
HumancATGC TTACAAGC AAG16194–16208
CM5′dPerchGTATGTATTTACACCATACA152–171
RuffeATATGTATTTACACCATACA152–171
ZanderATATGTATTTACACCATACA152–171
LungfishcCTATGTATATCGTACATTAA15537–15557
CSB DPerchTTCCTGGCATTTGGTTCC494–511
“Cichlid-a”cTTCCTGGCATCTGGTTCC371–388
CSB 1PerchATCTTAGGATATCAAGAGCATAA772–794
“Cichlid-a”CATAACTGATATCAAGAGCATAA640–662
SalmonidscATACTTGGATATCAAGTGCATAA726–742
CodATTAAAGTTTTTCAAGAGCATAA761–783
LungfishATCATATTTCACAGTGAACATAA16217–16239
HumancTAATTAATGCTTGTAGGACATAA209–231
CSB 2PerchTAAACCCCCCCTACCCCCCC860–879
HumanCAAACCCCCCCT-CCCCC299–315
CSB 3PerchTGAAAACCCCCCGGAAACA906–924
HumanTGCCAAACCC--AAAAACA346–363
PromoterPerchTATTTACA-TTATTAAAATGATGT964–976
Xenopus laevis dACARTTATA2130–2132 and 2183–2190
Chickend,eATATACA – TTATT1072–1083
  • a The position given refers to the original sequence (accession numbers are given in materials and methods), or the sequence in Figure 2 for the percids.

  • b This motif was repeated two to five times between the trnP and TAS 1 in perch, six times in zander, and between six and 23 times in ruffe. A three-unit sequence is shown in Figure 2.

  • c The cod sequence was obtained from Johansen et al. (1990), the lungfish sequence from Zardoya and Meyer (1996), the cichlid sequence refers to the cichlid-a sequence from Lee et al. (1995), the salmonid sequence is a consensus of the sequences in Shedlock et al. (1992), the human CSB-elements were taken from Chang and Clayton (1984) and Foran et al. (1988), the human Mt5 sequence was obtained from Ohno et al. 1991, and the Xenopus and chicken promoters were obtained from Bogenhagen and Yoza (1986), and L’Abbe et al. (1991), respectively.

  • d Conserved motif in the 5′ end of the control region (Figures 1 and 2).

  • e Only the sequence homologous to the perch and Xenopus is included for clarity.