Supplemental Table 1. Conservation of predicted recursive splice sites in D. melanogaster and D. pseudoobscura.

Top line = D. melanogaster

Bottom line = D. pseudoobscura

* = Estimated due to contig gap or exon not sequenced. ** = Region in contig gap or not sequenced.

CE = Cassette Exon. AT = Alternative 3' Exon.
Gene Name Intron Number Intron Length (nt) RP Location RP Sequence RP Score Notes
shaggy 2 CAUUUUCUUUCCAGGUAAGUUG
CCCUCUCUUUUCAGGUAAGUUG
89
80
 
     
 
UCUUCUAUUUGUAGGUAAGUGU
UUCUCUCUUUCUAGGUAAGUUU
84
83
 
dunce 1 UCUUAUCUUUUCAGGUAAGUUG
UUUUCUCAUUUCAGGUGAGUGU
89
86
 
  4 UUCCUUUCUUCCAGGUGAGUUC
UGAUUUCUUUGCAGGUGAGUUU
85
85
 
     
 
UUUUUUCUUUACAGGUAAGUCG
UUUCUUUUUUACAGGUGAGUGU
94
91
 
     
 
  UUUUCUCUUUACAGGUAAGUCG
**
91  
Fasciclin 2 2 UUUUCUCCUUCCAGGUAAGUGU
UCUCUUUCUUUCAGGUAAGUGU
92
90
 
     
 
UGUUUCUUUUGCAGGUACGUGC
CAAACUCUUUGCAGGUAUGUGU
83
70
 
CG9650 1 CUCUCUAUUUCCAGGUGAGUUG
UCUUUUCUUUGCAGGUGAGUUC
79
89
 
cut 1 UUCUUCUUUUACAGGUAUGUUU
UUAUUUAAUUGCAGGUAUGUGA
86
79
 
retinal degeneration A 3 UCUUUUACUUGCAGGUACGUAA
GCGUUCUUUUGCAGGUACGUAA
85
76
 
alpha Mannosidase I 1 * UCUUUUACUUUCAGGUGAGUUG
ACGUUUACUUUCAGGUGAGUAG
88
80
 
     
 
  AUUUCCCAUUGCAGGUGAGUUA
**
83  
CG32666 2 * UUGUUUACUUGCAGGUAAGAGA
GUUUGUUUUUACAGGUAAAAGA
81
69
 
Displaced by 407 nt
     
 
UUCUUUUUUUACAGGUAAGCUU
CUCUUUCUUUACAGGUAAGAUA
87
81
 
Tenascin accessory 1 *   CUCUUCUCUUUCAGGUAUGUAU
**
83  
multiple edematous wings 3 *   UUCGUCUUUUUCAGGUAUGUAC
Not Found
80 CE
 
flotillin 2 2 CUUUGUAUUUACAGGUGAGUGA
UAUCUCCCUUACAGGUGAGUGG
83
84
 
     
 
AUCUUUCAUUACAGGUAAGCUU
UUCUUUCAUUACAGGUUAGUUC
79
81
 
bazooka 1 UUAUCUACUUGCAGGUAAGAUA
UUAUUUACUUUUAGGUAAGAGC
80
76
 
CG32560 3 UCCACUACUUACAGGUGAGUAC
UUUACUAUUUGCAGGUGAGUAC
78
86
 
Shaker 1 UUUUCUAAUUUCAGGUGAGUAA
UCUUCUCUUUGCAGGUGAGUUA
88
86
 
Beadex 1 CCUUGUUUUUCCAGGUAAGUGU
CUCUCUCUUUCCAGGUAAGUGU
85
83
 
CG32521 1 UUAUCUCGUUGCAGGUGAGUUU
UAUCUCGUUCGCAGGUGAGUGU
82
78
 
split ends 2 UUUUUUAUUUAUAGGUGCGUAU
UUUGUAUUUUCCAGGUGCGUAU
82
80
 
dachsous 2 AUCUUUUAUUUCAGGUAAGUCC
CUCUAUCUUUACAGGUAAGCCA
84
75
 
leak 1 UCUUCUCUUUCUAGGUAAGCAA
CUCUUUCGUUUUAGGUAAGGAA
79
71
 
CG14351 2 UUCUUUCUUUCUAGGUAAGCGA
UUCUGUCUUUCCAGGUAUGUCA
77
76
 
CG31666 2 UUUUUUUUUUGCAGGUAAGCAC
UUUCUCUCAUUGAGGUAAGCGA
91
70
 
     
 
CUUUUUACUUACAGGUAACUAU
CCUUCUACUUACAGGUAACUAA
84
76
 
lilliputian 2 CUUUUUCUUUGCAGGUGAGUCA
UUGUUUCUUUACAGGUGAGUCA
87
85
 
     
 
UCUUUUCUUUGCAGGUGAGUUC
UUUUCUCUGUGCAGGUGAGUUG
89
82
 
echinoid 2 * CCAUUUCAUUUUAGGUAAGUUA
UCGUCUCUUUUUAGGUAAGUCU
78
77
 
     
 
CUUCUCGUUUGCAGGUAAGCUU
CUCUCUCUUUGCAGGUAAGCAA
81
78
 
CG15630 1 UUUGUCUCCUGCAGGUACGUAC
UUUGUCUCCUGCAGGUACGUAC
80
80
 
thickveins 2 UCUUUUCAUUUCAGGUAAGUGU
UUCUUUUGUUUCAGGUAAGUUU
90
89
 
Rapgap1 1 UUUUUUCUUUGCAGGUUAGUAC
UUUGCUCUUUGCAGGUUAGUAA
90
82
 
CG32982 9 CUUUCUCUUUCCAGGUGAGUUG
UUGUGUAUUUUCAGGUGAGUUU
85
82
 
Sema-1a 3 UCUAUUUCUUUUAGGUAAGCUG
AUUUUUCAUUGCAGGUAAGCUU
77
83
 
taiman 2 * UCUUCUCAUUGCAGGUAUGUAU
AUUUUUCCUUUCAGGUAUGUAA
82
85
 
     
 
  UUCUUUCUUUGCAGGUAAGCAA
**
86  
Nicotinic Acetylcholine Receptor 30D 2 UCUUUUACUUACAGGUAAGUGC
UCUUUUACUUACAGGUAAGUGC
86
90
 
CG31721 2 UCUCUCUUUUUCAGGUAUGUUA
CCUCUCUUUUUCAGGUACGUUA
84
79
 
     
 
AUUUUUUAUUGCAGGUAUGUUA
UUCUUUCGUUGCAGGUACGUUC
83
78
 
CG31757 3 UCAUUUCAUUGCAGGUAAGUCA
UCGUUUCAUUGCAGGUAAGUCA
85
82
 
bunched 3 * UCUUUUAUUUUCAGGUAAGCAA
UCUUUUAUUUGCAGGUAAGCAA
87
87
 
     
 
CUCUUUUUUUUCAGGUAUGUAU
UCUUUUAUUUACAGGUAUGUUG
83
84
 
  4 * UCUUCUCUUUGCAGGUAAGCAA
UCUUCUCUUUGCAGGUAAGCAA
84
84
 
kuzbanian 3 UCUUCUCUUUACAGGUGAGUGC
UUCUCUCUUUACAGGUGAGUGC
85
83
 
     
 
UUUAUUUUUUUCAGGUAAUUUG
UUUUUUUUUUCUAGGUAAGAUC
83
83
 
centaurin gamma 1A 1 UUUCUUUCUUUCAGGUAAGCUC
CUUCUUUUUUGCAGGUAAGCAU
86
85
 
outspread 1 * ** UGUUCUCGUUUCAGGUAUGUAC
CGUUCUCGUUUCAGGUAUGUAC
80
73
 
  2 UUCUUUUCUUUCAGGUGAGUUA
UUCUUUUCUUUCAGGUGAGUUA
89
89
 
CG15138 2 UCUUUGUUUUUCAGGUAAGUCG
CUUUGUCUUUUCAGGUAAGUCG
88
84
 
Cadherin-N 11   AUUCAUUCUUUCAGGUAUGUAA
Not Found
81  
Fasciclin 3 2 * UCUUUUCGUUACAGGUAUGUAU
UCUUUUAUUUACAGGUAAGUUU
84
94
 
Furin 1 1 * ** UUCUCUCUUUGCAGGUAAGCCA
UUUUCUCUUUAAAGGUAAGCCA
79
76
 
complexin 3 UCUUUUAUUUACAGGUAAGCGU
UCUUAAAUUUUCAGGUAAGCGU
86
79
 
prickle 1 UUUUCUCGUUACAGGUAAGUUG
CGCUCUCAUUCCAGGUAAGUUG
88
76
 
pipsqueak 3 CUUUCUCUUUGCAGGUAAGCCA
CUUUCUCUUUGCAGGUAAGCGC
80
80
 
frazzled 1   AUUCUCCUUUGCAGGUGAGUGC
Not Found
84  
faint sausage 3 UGUUCUCUUUCUAGGUAAGUGC
CUCUCUCUUUGCAGGUAAGAAA
81
78
 
     
 
  UUUCUUCUUUGCAGGUAAGUUC
Not Found
92  
mastermind 2 UUCUCUCGUUGCAGGUGAGUUU
CUCUCUCGUUGCAGGUGAGUUC
81
76
 
muscleblind 2 *   UCUUCUUUUUUCAGGUAUGUAC
**
84 AT
 
     
 
  CUAUCUAUUUUCAGGUAAGUUU
Not Found
86  
 
     
 
  UCUAUUCUUUGCAGGUGAGUGU
CUCUCUCGUUGCAGGUAUGUUU
86
72
 
Displaced by 150 nt
     
 
  UCUUCUAUUUCCAGGUAAAUUU
CUCUCUCGUUACAGGUAAGACA
81
71
 
serrano 4 CUAUCUAUUUGCAGGUAAGUCU
UUGUUUCUUUUCAGGUAAGUGC
83
88
 
smooth 10   UACUCUCUUUGUAGGUAAGUUU
Not Found
80  
     
 
UACUCUCUUUGUAGGUAAGUUU
UUUUCUCAUUUUAGGUAAGUUU
80
85
 
  11 * ** CCCACUCACUACAGGUAAUUCC
ACUGAUCUUACCAGGUAAGUCC
90
71
 
  12 UUUUGUCUUUUCAGGUAAGUCG
CUUCUUACUUGCAGGUAAGUCG
88
85
CE
CE
Epidermal growth factor receptor 6 UUCCAUCUUUGCAGGUGAGUUC
UCUUCUCGUUGCAGGUGAGUUU
81
83
 
CG13499 2     UCUAUUUCUUACAGGUAACUAU
**
83  
plexus 2 UUUGUUUCUUGCAGGUGAGUGU
UCUGUCUCUUUCAGGUGAGUUU
88
86
 
nahoda 1 * 469
 
UUCUCCUCCUUCAGGUGAGUUC
Not Found
81  
bric a brac 1 1 * CUUUAUCGUUACAGGUAAGUUC
UUGUUUCGUUGCAGGUAAGUGU
85
85
 
CG32296 1 UUGUAUCUUUGCAGGUGAGUUU
CUUCUUUUUUGCAGGUAAGUUC
84
90
 
Ecdysone-induced protein 63E 1 AUUUUUUAUUCCAGGUAAGUUC
AAUUUUCGUUUCAGGUAAGUUC
90
84
 
CG32264 1 CUCUUCUCUUGCAGGUAAGUUU
UAUCUCUUUUGCAGGUAAGUCU
89
89
 
  4 UCUUUAUUUUCCAGGUGAGUUU
UGUUCCCUUUCAGGGUGAGUUU
89
64
 
Cip4 2 UCUUUCUCUUGCAGGUAAGUUG
UCUUUGUUUUCCAGGUAAGUUU
93
90
 
Guanine nucleotide exchange fa 2 * ** CUUUUUCGUUUCAGGUUAGUAG
UGGUUUGUUUUCAGGUUAGUAG
82
77
 
CG32423 3 CUAUUUUUUUGCAGGUAAGUUU
UAUCUUUUUUGCAGGUAAGUUU
90
91
 
still life 2 UUUUGCCAUUGCAGGUAAGCUA
UUUUUCCUUUGCAGGUAAGCAU
81
90
 
CG18769 3 UCUUUUAUUUACAGGUGAGUUG
UACUCCAUUUGCAGGUGAGUUA
89
80
 
PAR-domain protein 1 1 GGUUUUCUUUAUAGGUGAGUAA
UUCUCUAUUUGCAGGUGAGUUU
79
84
 
     
 
UCUUUUAUUUACAGGUAAGCAU
UAUUUCAUUUCCAGGUAAGCUU
88
86
 
nemo 3 * ** UUCUCUCUUUUUAGGUAAGUUC
CUUUCUCGUUUUAGGUAAGUUU
82
80
 
CG32062 2 UCUUUUCUUUGCAGGUACGUUU
UCUUUUCGUUGCAGGUACGUUU
86
81
 
     
 
CUUUUUCAUUACAGGUAAGUUU
CUUUUUCAUUACAGGUAAGUUG
91
89
 
     
 
UCUUCUAUUUGCAGGUACGUCU
UUUACAUUUUGCAGGUACGUCU
80
78
 
     
 
UCUAUUUCUUUCAGGUAUGUUU
UGCCUUUCUUUCAGGUAUGUCC
84
74
 
division abnormally delayed 1 UUCUCCAUUUGCAGGUGCGUAU
UCCUCCGUUUGCAGGUGUGUAU
78
73
 
Mob1 2 UGUUUUCCUUUCAGGUGAGUGU
CUCCUCUCUUUCAGGUGAGUAA
87
83
 
rolling pebbles 2 CUUUUUCUUUCCAGGUAAGUUU
UUUUCUACUUUUAGGUAAGUCU
93
85
 
bruno-3 1 UUGUUUCUUUCCAGGUAAGUGA
UUCUUUACUUACAGGUAAGUGA
89
89
 
  3 GUCUGUCUUUGCAGGUAAGUUG
AUGUGUCUUUCCAGGUAAGUUG
80
80
CE
CE
  6 CUCUCUCUUUUCAGGUAAGUUC
CUCUCUCUUUCCAGGUAAGUUC
84
83
 
nuclear fallout 6 UCCUUUAUUUCCAGGUAAGCAA
GGCCCUCUUUUUAGGUAUUUAC
82
53
 
frizzled 1 UCUGUUUCUUUUAGGUAAGUCU
UCUGUCUAUUGCAGGUACGUGU
83
78
 
  4 UCCUCUUCUUUCAGGUAUGUAC
UUUCCAUCUUUCAGGUAUGUAA
78
81
AT
AT
     
 
UCUUUUCAUUUCAGGUAUGUAA
UCUUGUCGUUGCAGGUAUGUUA
84
76
 
dally-like 1 UGCUCUCAUUACAGGUAAGUUC
GCUUUCUUUUGCAGGUAAGUAC
81
89
 
CG33158 3 * UUUUCUCAUUUCAGGUAAGUCC
UCUUUUCAUUUCAGGUGAGUCU
88
86
 
Ecdysone-induced protein 75B 1 UCCUUUUCUUGCAGGUAUGUAC
CCGUCUCGUUACAGGUAUGUAC
82
69
 
     
 
UAUUCUACUUUCAGGUAAGUCA
GUUUUUCAUUUCAGGUAAGUCA
87
86
 
     
 
  UCUUUCCAUUCCAGGUGAGUGA
Not Found
86  
  2   UCUUUCCAUUGCAGGUAAGCUU
Not Found
84  
CG6896 2 UCUCUUUAUUUCAGGUAUGUUA
UUCUUUCUUUUUAGGUAAGAUG
81
78
 
Displaced by 103 nt
naked cuticle 1 UCUUUUCCUUGCAGGUGUGUAC
CCGUUUCCUUGCAGGUGUGUAC
82
73
 
CG32223 2 UAUUUUUAUUCCAGGUAAUUAC
CUGUUUUAUUUCAGGUAACUCC
82
72
 
CG6014 1 AUUUCCCUUUGCAGGUAAGUUC
UCUUUUCAUUGCAGGUAAACGC
88
72
 
Tenascin major 1 * UUCUUCUAUUACAGGUGAGUAA
AAUUUCCUUUUCAGGUGAGUAA
88
87
 
     
 
  UCUUCUGCUUUCAGGUAUGUAA
**
81  
CG33202 1 UCUCUCCUUUUUAGGUAAGCAU
UCUCUCUUUUUUAGGUAAAGCA
80
66
 
polychaetoid 1 UUUUUUCGUUGCAGGUAUGUAU
UUUUUUUUCCUCAGGUAUGUAU
86
82
 
pumilio 8 AUUUUUUUUUGCAGGUGAGUUU
UCCUUUCCUUGCAGGUGAGUUG
91
83
 
     
 
CUUUUUCUUUGCAGGUAGGUGA
CUUUCUCGUUGCAGGUAGGUGA
83
75
 
     
 
UCUUUUCUUUGCAGGUAAGUUU
UUGUUUCUUUGCAGGUGAGUUU
94
87
 
     
 
UCCUUUUCUUUCAGGUAAGUUC
CGUUUUCGUUUCAGGUAAGUUU
89
84
 
     
 
UCUUCUCAUUGUAGGUAAGUCC
UCUUCUCAUUCUAGGUAAGUCC
79
79
 
     
 
UUUUCUCUUUACAGGUAAGUGA
UUUGCUAUUUCCAGGUAAGUGA
92
86
CE
CE
     
 
UUCUCUCUUUUUAGGUAAGUUU
CGCUCUCUUUUUAGGUAAGUUC
84
74
 
pasilla 1 UCUUUCCAUUUCAGGUGAGUCA
CUUUGCCAUUUCAGGUGAGUCA
85
79
CE
CE
CG31363 1 UUCUCUUUUUGCAGGUAAGUUC
CCGUCUCUCUCCAGGUAUGUUU
88
69
 
CG3563 1 UUCUUUUUUUGCAGGUGAGUUC
UUUCACUUUUGCAGGUGAGUUC
89
86
 
Ultrabithorax 3 GCUUGCAUUUUCAGGUAAGAUA
GGUUGCAUUUUCAGGUAACAUA
74
63
CE
CE
     
 
UCUAUUUUUUCCAGGUAAGAGA
UUUCUGUUUUCCAGGUAAGAGA
82
81
CE
CE
     
 
CUUCUCUUUUCUAGGUAAGUGU
UUCUCUUCUUUUAGGUAAGUGU
85
83
 
couch potato 2 UUUUAUCUUUGCAGGUGAGCUA
CUCUUUUUUUACAGGUGAGUUU
83
87
 
fruitless 9 UUCUACUUUUCUAGGUAAGUCC
UUCUAUAUUUCUAGGUAAGUUU
81
82
 
dystrophin 22 UAUUUCUCUUGCAGGUAUGUAC
AUUAUUUUUUUCAGGUAUGUAA
86
84
 
Displaced by 488 nt
     
 
CUUUUUCAUUGCAGGUAAGCGU
UUUUUUCAUUGCAGGUAAGCGU
82
85
 
CG5060 1 * UCCUUAUUUUUCAGGUAUGUAC
UUUUGUUUUUUCAGGUACGAUU
80
77
 
CG31176 1 CUUUUCUAUUACAGGUAUGUAC
UCUGUUCCUUUCAGGUAUGUAC
84
80
 
 
held out wings 2 UCGUUUACUUGCAGGUGAGUUU
UUGUUUAUUUGCAGGUGAGUUU
84
87
 
CG31163 3 * UUUAUUCGUUCUAGGUGAGUUU
CUCUCUCUUUUUAGGUAAGUUU
80
80
 
  4 * AUUUCUCGUUUCAGGUAAGUUG
CUUUUUCGUUUCAGGUAAGUUC
84
87
 
     
 
UCUUUUAAUUGCAGGUAAGCUC
UCUUCUAAUUGCAGGUAAGCUC
82
79
 
     
 
  UCUUCUACUUCCAGGUAAGCUG
**
81  
klingon 2 * UUAUUUAUUUGCAGGUGAGUUC
UUAUUUAUUUGCAGGUAAGUCC
88
88
 
Pellino 2 CUCUUCUUUUGCAGGUAAGUUU
AUUUUUUUUUGCAGGUAAGUUU
89
94
 
Nicotinic Acetylcholine Receptor alpha-96Aa 2 UUCUUUGCUUGCAGGUGAGUUG
UUGUUUUCUUGCAGGUGAGUCA
85
85
 
musashi 2 UUUCUUUCUUUCAGGUAAGCAA
UUCUUUCAUUUCAGGUAAGCGA
88
80
 
  4 UGUUUACUUUCCAGGUAAGUUC
UGUUUACUUUGCAGGUAAGUUC
88
88
 
Transcript 48 2 UUUCUCUCUUGCAGGUAAAUAA
UCUUUUCAUUGCAGGUAAACGA
86
72
 
Displaced by 265 nt
Toll 1 CUAUAUAUUUGCAGGUAAGCAG
UUUUUGUUACGCAGGUAAGCAU
78
76
 
kayak 1 CUCUCUCGUUGCAGGUAAGUAG
CUCUCUCGUUGCAGGUAAGUAG
80
80
 
headcase 1 ACAUUUCUUUGCAGGUAAGUGA
CGCUCUCUUUGCAGGUAAGUAA
84
81
 
  2 UCGUUUCGUUGCAGGUGAGUUU
CUCUCUCGUUGCAGGUGAGUUU
81
77
 
sanpodo 2 CAUUCUCUUUGCAGGUAAGCAA
UCUCUUUUUUGCAGGUAAGCAA
80
85
 
hephaestus 3     UCUUCUGCUUUCAGGUAAGUUU
**
88 CE
 
  4   ** CGAUUUAUUUACAGGUGAGUUA
CGAUUUAUUUACAGGUGAGUUA
81
80
 
klarsicht 1 UUCUUUCUUUACAGGUGAGUUG
CUUUUGCUUUUUAGGUGAGUGG
88
77
 
  5 UCUUCUCGUUUCAGGUAAGCAA
CCGUCUAUUUCCAGGUAAGCAA
80
74
 
     
 
UCUUCUCUUUCUAGGUAAGAAU
UCCUCUCUUUGCAGGUAAGUAU
79
87
 
CG40120 3 *   UUUUGUUUUUGCAGGUCAGUCU
**
83  
CG12567 1 * 352
 
CUUUUACCUUUCAGGUAAGAAA
**
84  
* = Estimated due to contig gap or exon not sequenced. ** = Region in contig gap or not sequenced.

CE = Cassette Exon. AT = Alternative 3' Exon.