Abstract
The MAT locus of Cryptococcus neoformans has a bipolar organization characterized by an unusually large structure, spanning over 100 kb. MAT genes have been characterized by functional genetics as being involved in sexual reproduction and virulence. However, classical gene replacement failed to achieve mutants for five MAT genes (RPL22, RPO41, MYO2, PRT1, and RPL39), indicating that they are likely essential. In the present study, targeted gene replacement was performed in a diploid strain for both the α and a alleles of the ribosomal genes RPL22 and RPL39. Mendelian analysis of the progeny confirmed that both RPL22 and RPL39 are essential for viability. Ectopic integration of the RPL22 allele of opposite MAT identity in the heterozygous RPL22a/rpl22αΔ or RPL22α/rpl22aΔ mutant strains failed to complement their essential phenotype. Evidence suggests that this is due to differential expression of the RPL22 genes, and an RNAi-dependent mechanism that contributes to control RPL22a expression. Furthermore, via CRISPR/Cas9 technology, the RPL22 alleles were exchanged in haploid MATα and MATa strains of C. neoformans. These RPL22 exchange strains displayed morphological and genetic defects during bilateral mating. These results contribute to elucidating functions of C. neoformans essential mating type genes that may constitute a type of imprinting system to promote inheritance of nuclei of both mating types.
INFECTIOUS diseases cause significant morbidity and mortality worldwide in both developed and developing countries. Fungal infections are common in humans and impact the majority of the world’s population, but are often underestimated (Brown et al. 2012). The Cryptococcus species complex includes basidiomycetous fungal pathogens that can cause lung infections and life-threatening meningoencephalitis in both normal and immunocompromised patients, accounting for ∼1 million annual infections globally and almost 200,000 annual mortalities (Rajasingham et al. 2017). The drugs available to treat Cryptococcus infections are amphotericin B, 5-flucytosine, and azoles. These drugs are characterized by limited spectrum, toxicity, unavailability in some countries, and emergence of drug resistance (Brown et al. 2012).
In fungi, the mechanisms that govern sexual reproduction are controlled by specialized regions called mating type (MAT) loci. The genomic organization of MAT loci can differ among fungi. The tetrapolar mating type includes two MAT loci, the P/R locus encoding pheromones and pheromone receptor genes defining sexual identity and mate recognition, and the HD locus encoding homeodomain transcription factors that govern postmating developmental processes. In the tetrapolar system, the P/R and HD loci are located on different chromosomes, and segregate independently during meiosis, hence generating recombinant MAT systems. Conversely, in the bipolar mating system, both the P/R and the HD loci are linked on the same chromosome, and recombination in this region is suppressed. A variant of the bipolar system is a mating conformation called pseudobipolar, in which the P/R and the HD loci are located on the same chromosome, but unlinked, thus allowing (limited) recombination (Coelho et al. 2017).
Cryptococcus neoformans has a well-defined sexual cycle that is controlled by a bipolar MAT system derived from an ancestral tetrapolar state. The C. neoformans MAT locus evolved in a unique configuration as it spans over 100 kb and contains >20 genes that control cell identity, sexual reproduction, infectious spore production, and virulence. The two opposite C. neoformans MATα and MATa alleles include divergent sets of the same genes that evolved by extensive remodeling from common ancestral DNA regions. Both the MATα and MATa allele contain five predicted essential genes: RPO41, PRT1, MYO2, RPL39, and RPL22 (Lengeler et al. 2002; Fraser et al. 2004). Rpo41 is a mitochondrial RNA polymerase that transcribes mitochondrial genes and also synthesizes RNA primers for mitochondrial DNA replication (Sanchez-Sandoval et al. 2015). Prt1 is a subunit of the eukaryotic translation initiation factor 3 (eIF3), which plays a critical role in translation (Beznosková et al. 2015). Myo2 is a myosin heavy chain type V that is involved in actin-based transport of cargos and is essential in Saccharomyces cerevisiae (Johnston et al. 1991). Rpl39 and Rpl22 are ribosomal proteins.
This study focused on the MAT ribosomal proteins, demonstrating that both RPL39 and RPL22 α and a alleles are essential in C. neoformans. Because Rpl22 in yeast and vertebrates has been found to play specialized functions and extraribosomal roles (Gabunilas and Chanfreau 2016; Kim and Strich 2016; Zhang et al. 2017; Abrhámová et al. 2018), we aimed to characterize the functions of the C. neoformans RPL22α and RPL22a genes. We found that ectopic integration of an RPL22 allele failed to complement the essential phenotype due to mutation of the RPL22 allele of the opposite mating type. We found differential expression of the C. neoformans RPL22α and RPL22a genes during mating, and discovered an RNAi-mediated mechanism that contributes to control RPL22a expression. Next, using CRISPR/Cas9 technology, RPL22 alleles were exchanged in haploid MATα and MATa strains of C. neoformans, and this resulted in morphological and genetic defects during bilateral mating. In summary, these studies reveal a novel role for diverged essential ribosomal proteins in controlling fungal sexual reproduction.
Materials and Methods
Strains and culture conditions
The strains utilized in the present study are listed in Supplemental Material, Table S1. Heterozygous mutants were generated in the diploid C. neoformans strain AI187 (MATα/MATa ade2/ADE2 ura5/URA5) according to a previously developed strategy (Ianiri and Idnurm 2015). C. neoformans strain AI187 was generated through the fusion of strains JF99 (MATa ura5) and M001 (MATα ade2) (Idnurm 2010). For transformation of haploid C. neoformans strains, we employed H99α and KN99a (Nielsen et al. 2003). All of the strains were maintained on yeast extract-peptone dextrose (YPD) agar medium.
Molecular manipulation of C. neoformans
For the generation of heterozygous mutants, 1.5 kb regions flanking the genes of interest were amplified by PCR and fused with the NAT marker through in vivo recombination in S. cerevisiae as previously described (Ianiri and Idnurm 2015). Split-marker gene replacement alleles were amplified from S. cerevisiae transformants with primers JOHE43263/ALID1229 and JOHE43264/ALID1230, in combination with ai37 and JOHE44324, respectively. The amplicons were precipitated onto gold beads and transformed into C. neoformans with a Bio-Rad particle delivery system (Toffaletti et al. 1993); W7 hydrochloride was added to YPD + 1 M sorbitol to increase the efficiency of homologous recombination (Arras and Fraser 2016). Transformants were selected on YPD + NAT and screened for homologous recombination events by PCR with primers external to the replaced regions in combination with primers specific for the NAT marker, and with gene-specific internal primers. The primers used are listed in Table S2.
For complementation experiments, a region of 2397 bp including the RPL22α gene with its promoter and terminator was amplified by PCR from C. neoformans H99α genome and cloned in pCR2.1 according to the manufacturers’ instructions. Similarly, a region of 2648 bp including the RPL22a gene with its promoter and terminator was amplified by PCR from C. neoformans KN99a genome and cloned in pCR2.1 according to manufacturers’ instruction. Plasmids were recovered from Escherichia coli TOP10 and sequenced to identify error-free clones (Table S2). Sequence confirmed plasmids were digested with SpeI–XhoI and SpeI–NotI to obtain regions including the RPL22α and RPL22a genes, respectively. These fragments were purified and subcloned within the pSDMA57 plasmid for safe haven complementation (Arras et al. 2015) digested with the same enzymes. The recombinant plasmids were recovered from E. coli TOP10, linearized with AscI, PacI, or BaeI, and transformed through biolistic in C. neoformans heterozygous mutants GI56 (RPL22α/rpl22aΔ) and GI81 (RPL22a/rpl22αΔ) as described above. C. neoformans transformants were selected on YPD + neomycin G418, and subjected to DNA extraction and PCR analyses to identify transformants having the correct insert within the safe haven region (Arras et al. 2015).
The recently developed TRACE technology (Transient CRISPR/Cas9 coupled with electroporation) (Fan and Lin 2018) was utilized for the generation of the 5′Δ RPL22a strain GI228 and the RPL22 exchange alleles. For 5′Δ RPL22a, a homology-directed repair (HDR) template consisting of 1.5-kb sections flanking the region upstream RPL22a targeted by sRNA was fused with the NAT marker through in vivo recombination in S. cerevisiae as described above.
For generation of the RPL22 exchange alleles, we developed a dual CRISPR/Cas9 system to exchange the two different RPL22 alleles alone, and insert selectable markers (NAT or NEO) separately in the safe haven 2 (SH2) region. HDR templates were generating by fusing ∼1.0 kb fragments flanking the RPL22 genes with the ORF of the opposite RPL22 gene. For the generation of a chimeric cRPL22α (c = chimeric), the N-terminal region of RPL22α (from nucleotide 1 to 268) and the C terminal region of RPL22a (from nucleotide 253 to 600) were combined together by PCR, fused with ∼1.0 kb regions flanking the RPL22a gene, and employed as an HDR template. All HDR templates were assembled using overlap PCR as described in Davidson et al. (2002).
Specific guide RNAs (gRNA) were designed according to Fang et al. (2017) using EuPaGDT (http://grna.ctegd.uga.edu/), available on FungiDB (https://fungidb.org/fungidb/). Complete gRNAs were generated by one-step overlap PCR, in which a bridge primer that comprises the 20-nucleotide gRNA guide sequences was utilized to integrate the U6 promoters (amplified from Cryptococcus deneoformans XL280 genomic DNA) and the gRNA scaffold [amplified from the plasmid pYF515 (Fang et al. 2017)]. CAS9 was amplified from pXL1-Cas9 (Fan and Lin 2018). The SH2 sequence was obtained from (Upadhya et al. 2017). All PCR amplifications were conducted using Phusion High-Fidelity DNA Polymerase (NEB). C. neoformans was transformed with CAS9, gRNAs, and HDR templates through electroporation following the previously reported protocol (Fan and Lin 2018). Transformants were screened for homologous recombination events by PCR as previously indicated.
Genetic analyses and scanning electron microscopy of reproductive structures
The heterozygous strains generated were grown on Murashige-Skoog (MS) medium to induce meiosis and sporulation. Haploid C. neoformans mutants were crossed with C. neoformans wild type (WT) strains of compatible mating type (H99 MATα and KN99a MATa) on MS medium, and monitored for the formation of sexual structures. Spores were micromanipulated and allowed to germinate onto YPD agar for 3–4 days at 30°, and then tested for the segregation of the genetic markers. For the heterozygous strains, the markers were nourseothricin resistance (NATR) or sensitivity (NATS), ura5/URA5, ade2/ADE2, MATα/MATa, plus neomycin G418 resistance (NEOR) or sensitivity (NEOS) for the complementing strains. For the haploid strains, they were either NATR-NATS or NEOR-NEOS, and MATα or MATa. The analyses were performed by spotting 2 µl of cell suspensions onto YPD + nourseothricin (100 µg/ml) or neomycin (100 µg/ml), YNB + adenine (20 mg/Liter) or YNB + uracil (40 mg/Liter). The mating type was scored by crossing haploid progeny to strains KN99a and H99 on MS media supplemented with adenine and uracil, and by evaluating the formation of sexual structures by microscopy (Idnurm 2010; Ianiri and Idnurm 2015). For NATR colonies, the mating type was confirmed by PCR with primers JOHE39201-JOHE39202 (MATa) and JOHE39203-JOHE39204 (MATα).
For strain YFF116 (rpl22a::RPL22α NEO), genetic segregation of the MAT and NEO markers was carried out by crossing YFF116 x H99α on MS, and by dissecting recombinant progeny as described above. Progeny that germinated were subjected to 10-fold serial dilution on YPD, YPD + neomycin, and hydroxyurea (125 mM). To evaluate the consequences of the rpl22a::RPL22α genetic modification in unilateral and bilateral mating without the influence of the NEO marker, NEOS MATa progeny were crossed both with H99α and the YFF92 strain.
Scanning electron microscopy (SEM) was performed at the North Carolina State University Center for Electron Microscopy, Raleigh, NC. Samples were prepared for SEM as previously described (Fu and Heitman 2017). Briefly, a small MS agar block containing hyphae was excised and fixed in 0.1 M sodium cacodylate buffer, pH 6.8, containing 3% glutaraldehyde at 4° for several weeks. Before imaging, the agar block was rinsed with cold 0.1 M sodium cacodylate buffer, pH 6.8, three times and postfixed in 2% osmium tetroxide in cold 0.1 M cacodylate buffer, pH 6.8, for 2.5 hr at 4°. Then the block was critical-point dried with liquid CO2 and sputter coated with 50 Å of gold/palladium with a Hummer 6.2 sputter coater (Anatech). The samples were viewed at 15KV with a JSM 5900LV scanning electron microscope (JEOL), and captured with a Digital Scan Generator (JEOL) image acquisition system.
RT-qPCR analysis during mating and statistical analysis
For RT-qPCR analysis of RPL22 expression during mating, strains were grown overnight in liquid YPD, and cellular density was adjusted to 1 × 109 colony-forming units (CFU)/mL. Equal amounts of each cellular suspension of strains to be analyzed were mixed, and five spots of 300 µl were placed onto one plate of MS agar per day of incubation. Control conditions were the single strains on YPD agar (two spots of 300 µl per day of incubation). Every 24 hr, cells were scraped off the MS plate, washed once with sterile water, lyophilized, and kept at −80° until RNA extraction. RNA extraction was performed with the standard TRIzol protocol following the manufacturers’ instructions (Rio et al. 2010). Extracted RNA was treated with DNase and purified with an RNA clean and concentration kit (Zymo Research). Then, 3 µg of purified RNA were converted into cDNA via the Affinity Script QPCR cDNA synthesis kit (Agilent Technologies). cDNA synthesized without the RT/RNase block enzyme mixture was utilized as a control for genomic DNA contamination. Approximately 500 pg of cDNA were utilized to measure the relative expression level of target genes through quantitative real-time PCR (RT-qPCR) using the Brilliant III ultra-fast SYBR green QPCR mix (Agilent Technologies) in an Applied Biosystems 7500 Real-Time PCR System. A control without template RNA was included for each target. Technical triplicates and biological triplicates were performed for each sample. Gene expression levels were normalized using the endogenous reference gene GDP1 and determined using the comparative ΔΔCt method.
To determine whether the relative gene expression levels between strains of the same mating reaction in the same day of incubation (for example, RPL22α and RPL22a expression in WT H99α x KN99a cross after 48 hr of incubation) exhibited statistically significant differences (P < 0.05, P < 0.01, P < 0.001), the unpaired Student’s t-test with Welch’s correction was applied. To compare the results of different strains in different mating reactions, ordinary one-way ANOVA with Tukey’s multiple comparison test was applied. Because in these comparisons we were interested in monitoring the changes in gene expression following genetic manipulation, only statistically significant differences (P < 0.05, P < 0.01, P < 0.001) were displayed for the expression levels of the same gene on the same day of incubation in separate mating reactions (for example, RPL22a expression in WT H99α x KN99a cross compared to RPL22a expression in rdp1Δ x rdp1Δ bilateral cross after 48 hr of incubation). Statistical analyses were performed using the software PRISM8 (GraphPad, https://www.graphpad.com/scientific-software/prism/).
RNA structure modeling
RNA structure modeling was conducted with RNAfold (Lorenz et al. 2011) with default settings.
sRNA data processing
Small RNA (sRNA) sequencing libraries from C. neoformans WT H99 × KN99a cross and rdp1Δ bilateral cross are as described in Wang et al. (2010). The adapters sequences (5′-: GTTCAGAGTTCTACAGTCCGACGATC; 3′-: TCGTATGCCGTCTTCTGCTTGT) were removed by using cutadapt v1.9 (Martin 2011), and trimmed reads were mapped with bowtie v1.2.2 (Langmead et al. 2009) against the MATa (AF542528.2) and MATα (AF542529.2) loci from C. neoformans strains 125.91 and H99, respectively (Lengeler et al. 2000). Mapping was performed by allowing a single nucleotide mismatch, and up to five alignments within both mating type loci and the H99α genome. Furthermore, reads showing a single perfect match were considered in order to identify their genetic origin. Read counts were calculated with the depth function of SAMtools, and by using custom made Perl scripts (Li et al. 2009; Dahlmann and Kück 2015). The read counts were normalized against tRNA mapping reads (tRNA read counts per 100,000 reads). The normalization factors for the WT mating and the rdp1Δ mating were calculated with 1.386 and 0.728, respectively.
Chemical genetic screen and phenotypic analysis
Phenotypic analysis was performed for all the strains listed in Table S1 with the standard 10-fold serial dilution method. Tested conditions and stresses included: temperatures of 4°, 25°, 30°, 37°, 38°, 39°; antifungal drugs, such as amphotericin B (AmB, 1.5 µg/ml), 5-fluorocytosine (5-FC, 100 µg/ml), fluconazole (FLC, 20 µg/ml), FK506 (1 µg/ml), rapamycin (1 µg/ml); cell wall and plasma membrane stressors, such as YPD and YP supplemented with NaCl (1.5 and 1 M, respectively) and sorbitol (2 and 1.5 M, respectively), and YPD supplemented with caffeine (10 mM), calcofluor white (4 mg/ml), Congo Red (0.8%); genotoxic, oxidative, nitrosative and other stress-inducing agents, such as ethidium bromide (10 µg/ml), sodium nitrite (NaNO2, 1.5 mM), UV (150 µJ × cm2), hydrogen peroxide (H2O2, 3 mM), cycloeximide (0.15 µg/ml), dithiothreitol (DTT, 15 mM), hydroxyurea (125 mM), tunicamycin (0.7 µg/ml), benomyl (2.5 µg/ml), cadmium sulfate (CdSO4, 30 µM). Unless indicated, plates were incubated at 30° for 3–6 days and photographed.
Data availability statement
Strains and plasmids are available upon request. The authors affirm that all data necessary for confirming the conclusions of the article are present within the article, figures, and tables. Supplemental material available at figshare: https://doi.org/10.25386/genetics.11440986.
Results
The MAT ribosomal genes RPL22 and RPL39 are essential
Both the α and a alleles of the five predicted MAT essential genes (RPL39, RPL22, MYO2, RPO41, and PRT1) were identified in the genomes of C. neoformans H99α and KN99a, and were subjected to targeted mutagenesis in the C. neoformans diploid strain AI187 according to the strategy reported by Ianiri and Idnurm (2015) with minor modifications. Briefly, cassettes for targeted gene replacement were generated by in vivo recombination in S. cerevisiae, and amplified by PCR to perform targeted mutagenesis via split-marker coupled with the use of the nonhomologous end joining (NHEJ) inhibitor W7 hydrochloride (Fu et al. 2006; Arras and Fraser 2016). These modifications were critical to increase the rate of homologous recombination, and allowed the generation of heterozygous mutants for both the MATα and MATa alleles of the RPL39, RPL22, and MYO2 genes. Despite these modifications, heterozygous mutants for RPO41 and PRT1 were not obtained. This study reports the genetic analysis of mutants for the MAT ribosomal genes RPL39 and RPL22, and further focuses on the characterization of the RPL22 gene.
Heterozygous mutants were confirmed by PCR analyses, and then transferred onto MS medium supplemented with adenine and uracil and allowed to undergo meiosis, sporulation, and basidiospores production. Spores were micromanipulated on YPD agar and subjected to phenotypic analysis to assess the segregation of the four available markers (URA5, ADE2, MAT, and NAT). Because the predicted essential genes were deleted by insertion of the NAT marker, the absence of NATR progeny indicates an essential gene function. The other three markers were tested to exclude defects in meiosis: while the URA5/ura5 and ADE2/ade2 loci were expected to segregate independently, the segregation of the MAT region was expected to be linked to the mutated alleles, with progeny being only MATa when derived from MATα heterozygous deletion mutants, and only MATα when derived from MATa heterozygous deletion mutants.
Heterozygous mutants for the MAT ribosomal proteins Rpl39 and Rpl22 produced basidiospores that displayed a rate of germination ranging from 36% to 41% (Table 1). Mendelian analysis of the progeny confirmed that both the MATa and MATα alleles of Rpl39 and Rpl22 encode an essential function (Table 1). Figure 1 shows an example of the genetic analysis performed on progeny derived from strains GI233 (RPL39a/rpl39αΔ) and GI56 (RPL22α/rpl22aΔ). As expected, in all cases, the progeny inherited only one MAT allele, which is the opposite of the mutated gene. One exception is that one NATR progeny was obtained from sporulation of the heterozygous RPL22α/rpl22aΔ; further PCR analysis revealed that this strain has the mutated rpl22aΔNAT, and an extra copy of the RPL22α gene, suggesting that its NAT resistance is likely due to aneuploidy of chromosome 5 (1n + 1), where the MAT locus resides.
The MAT locus contains essential genes encoding ribosomal proteins Rpl39 and Rpl22. Representative example of genetic analysis of two C. neoformans heterozygous mutants [GI233 (RPL39a/rpl39αΔ) and GI56 (RPL22α/rpl22aΔ)]. The first colony in red box in the top left corner represents the original heterozygous mutant from which the progeny analyzed originated. The remaining isolates were haploid germinated spore progeny grown on control medium YPD, YPD +NAT, SD –uracil, and SD –adenine. The MAT type of the progeny is indicated on the right panel (Δ indicates the heterozygous mutant).
The C. neoformans RPL22 alleles are highly similar
The RPL22a and RPL22α genes share 83% identity at the DNA level, and the encoded proteins differ in five amino acids that are located in the N-terminal region (Figure S1, A and B). With the exception of intron 1, which is 132 bp for RPL22α and 116 bp for RPL22a, both of the C. neoformans RPL22 genes contain four exons and three introns of identical length. Intron 1 shares ∼75% nucleotide identity, intron 2 shares ∼75% nucleotide identity, and intron 3 shares ∼60% nucleotide identity (Figure 2A). In silico analysis of intron features revealed a canonical NG|GTNNGT motif at the donor sites for both RPL22α and RPL22a, and both canonical and noncanonical acceptor motifs CAG|G/C for RPL22α and YAG|Y/G for RPL22a. Four branch sites were predicted for each RPL22 gene, with the canonical motif CTRAY being more represented (Figure 2B). Note that the vertical bar represents the exon–intron junction, and Y and R indicate nucleotides with pyrimidine and purine bases, respectively. The length of the predicted polypyrimidine tracts ranged from 9 to 33 nt, and they differed only in intron 1 (Figure 2A).
Intron analysis of C. neoformans RPL22 genes. (A) Alignment of introns 1, 2, and 3 of RPL22α and RPL22a. Donor and acceptor splice sites are indicated in red. Branch sites were predicted using a combination of the online software SROOGLE (http://sroogle.tau.ac.il/) (Schwartz et al. 2009) and SVM-BP finder (http://regulatorygenomics.upf.edu/Software/SVM_BP/): branch sites based on the algorithm of Kol et al. (2005) are represented in blue, those based on the algorithm of Schwartz et al. (2008) are in purple. Manual adjustments were performed based on the websites instructions and score prediction; both algorithms failed to identify a CTRAY canonical branch site of intron 3 of RPL22a (boxed). The polypyrimidine tracts are underlined. The percentage of identity is indicated in parentheses, while the length (in bp) of the introns is indicated at the end on each alignment. (B) Consensus sequences at the 5′ splice site, the branch site, and the 3′ splice site constructed using WebLogo 3.3. bits, binary digits (http://weblogo.threeplusone.com/). The canonical donor GT and acceptor AG are underlined.
The rpl22a mutant was not complemented by the RPL22α allele
We sought to determine whether the Rpl22 MAT proteins play a specialized role in C. neoformans. The first approach was based on the heterologous expression of RPL22a or RPL22α in the heterozygous mutants RPL22a/rpl22αΔ (strain GI81) and RPL22α/rpl22aΔ (strain GI56). Briefly, the RPL22 genes, including promoters and terminators, were cloned into plasmid pSDMA57 for safe haven complementation with the NEO selectable marker (Arras et al. 2015); the empty plasmid served as the control. NAT and NEO double drug resistance, coupled with PCR analyses to confirm safe haven integration and lack of plasmid catenation, were the basis for selecting transformants for analysis; in some cases, integration at the safe haven was not achieved, and a heterozygous mutant with ectopic integration of the plasmid was chosen for analysis.
Complementing heterozygous strains were sporulated on MS media, and segregation of the five markers available (NEO, NAT, MAT, URA5, and ADE2) was determined in the germinated progeny. The criteria for the successful complementation of the mutant phenotype were: (1) presence of both NATR and NEOR markers in which the progeny’s MAT region segregated with the mutated rpl22ΔNAT allele—this indicates that the ectopic integration of the RPL22-NEO allele was able to confer viability in progeny that inherited the essential gene rpl22 deletion (2) absence of only NATR progeny, because those that inherit the rpl22ΔNAT allele are inviable; (3) presence of NEOR progeny that, together with progeny sensitive to NAT and NEO, inherited the MAT allele that contains the nonmutated copy of RPL22. Progeny that were both MATa and MATα were expected to be NATR and either aneuploid or diploid.
Results from the complementation experiments in the heterozygous mutants are summarized in Table 2. For the heterozygous RPL22α/rpl22aΔ (GI56), ectopic introduction of a WT copy of RPL22a (strain GI151) was able to restore viability in the progeny, with the generation of three NATR and NEOR progeny that were MATa (Figure 3). Several attempts with both biolistic and electroporation of plasmid pSDMA57 + RPL22α in strain GI56 yielded a low number of transformants, a high percentage of plasmid catenation, and lack of integration at the safe haven. Nevertheless, in two independent experiments, two heterozygous RPL22α/rpl22aΔ + RPL22α mutants (strains GI102 and GI154) with a single ectopic copy of the plasmid pSDMA57 + RPL22α were isolated. Genetic analysis of basidiospores dissected from strain GI102 revealed surprising findings, with no NEOR progeny and two NATR progeny that had an extra copy of MATα, which includes the RPL22α gene and explains their NAT resistance (Figure 3). Regarding transformant GI154, out of 20 spores that germinated, only 1 was solely NATR, 3 were both NATR and NEOR, and all were both MATa and MATα. These results indicated that the RPL22α gene did not complement the rpl22a mutation. Finally, sporulation of strain GI104 bearing the empty plasmid pSDMA57 also produced one spore that was both MATa and MATα (Figure 3).
RPL22a complements to restore viability of rpl22a mutants, RPL22α does not. Genetic analysis of C. neoformans complemented NEOR strains GI151, GI102, GI154, and GI104 derived from heterozygous mutant GI56 (RPL22α/rpl22aΔ). The first colony in the top left corner represents the original heterozygous mutant from which the progeny analyzed originate (red boxes). The mating type in NATR colonies was scored by genetic crosses and by PCR with primers JOHE39201-JOHE39204. For PCR, the WT (H99 MATα and KN99a MATa) and the heterozygous strain that was analyzed were used as controls; the NATR progeny is indicated with “P” and the number that corresponds to the position in the plate. C, negative control.
Integration of RPL22α at the safe haven (strain GI86) restored viability in progeny derived from the heterozygous RPL22a/rpl22αΔ mutant, with the generation of four NATR and NEOR strains that were MATα. For RPL22a/rpl22αΔ + RPL22a, none of the transformants obtained had the plasmid integrated at the safe haven. Several transformants having a single ectopic copy of the plasmid were sporulated on MS media, but none was able to form basidiospores for genetic analysis; a representative strain (GI150) is included in Table 2. These results indicate that RPL22a/rpl22αΔ + RPL22a complementing strains failed to sporulate, and, hence, we could not assess proper functional complementation through genetic analysis of the meiotic progeny. Finally, as expected, introduction of the empty plasmid into RPL22a/rpl22αΔ (strain GI83) did not restore progeny viability.
RPL22a expression is regulated by the RNAi pathway
Next, we sought to determine the expression levels of the RPL22 genes during mating (H99 x KN99a) on MS medium in comparison to vegetative growth on YPD agar. While after 24 hr of incubation both RPL22 genes were expressed at a similar level, at 48 hr, RPL22α expression drastically decreased and remained lower than that of RPL22a up to 96 hr (Figure 4A). Expression of RPL22a was also higher than RPL22α during vegetative growth on YPD, reflecting the results obtained during mating (Figure S2). These results indicate that the two RPL22 alleles are differentially expressed, with RPL22a expression being higher than RPL22α during both vegetative growth and mating.
RNAi contributes to control expression of RPL22a. RPL22α and RPL22a expression during C. neoformans mating between WT H99α × KN99a cross (A), rdp1Δ and gwc1Δ bilateral crosses (C and D), and GI228 × H99 cross (E) for 24, 48, 72, and 96 hr of incubation. Ct values were converted to expression level (fold change) through comparison with the endogenous reference GDP1 (ΔΔct analysis); asterisk indicates P < 0.05 for each RPL22α and RPL22a comparison for the same day of incubation. Note the different scales on the y-axes of the graphs in A–C and D–E. (B) sRNA obtained during H99α × KN99a cross (black) and rdp1Δ bilateral cross (red) were mapped to the reference MATa locus of C. neoformans (accession number AF542528.2); genes are represented in gray in the middle panel; in blue the LTR and transposable elements. LTR11, LTR14, and RPL22a of interest in this study are indicated in bold.
What are the mechanisms that control RPL22 expression? Our hypothesis was that inefficiently spliced introns of RPL22α could trigger RNA interference (RNAi) through the SCANR complex, with subsequent silencing of the gene (Dumesic et al. 2013). Analysis of intron retention (IR) and splicing pattern of RPL22α in several conditions revealed that intron 1 of RPL22α is subject to IR, whereas there is minimal IR for introns 2 and 3 (Figure S3). Mapping small RNA data from an H99α x KN99a cross against the MATa and MATα regions, we found that no reads mapped against the RPL22 genes, including intronic regions and intron–exon junctions. This observation argues against the hypothesis that there is a direct role for RNAi in governing RPL22 gene expression.
Interestingly, analysis of the region surrounding the RPL22 genes revealed that >54,989 sRNA reads map to the 2.2 kb region upstream of the RPL22a gene, which includes the LTR11 and LTR14 elements, and a candidate long noncoding RNA (lncRNA) predicted based on BLAST analyses. Several sRNA mapping parameters were tested to evaluate whether the sRNA reads map to multiple locations in the genome of C. neoformans, allowing us to determine the origin of sRNA reads that were mapped to the 5′ upstream region of RPL22a. We found that the majority of the reads originated from the 5′ upstream region of the RPL22a gene, while others originated from regions of the genome distant from MAT, corresponding to the lncRNAs CNAG_12037 and CNAG_13142, and the region upstream of the lncRNA CNAG_12435.
Analysis of the region upstream of the RPL22a gene in an rdp1Δ MATα x rdp1Δ MATa bilateral cross revealed a drastic reduction in sRNA reads (Figure 4B), consistent with a role for RNAi in governing these sRNA. We then performed RT-qPCR of the rdp1Δ x rdp1Δ bilateral cross, and found that RPL22a expression was lower than RPL22α expression at 72 and 96 hr of incubation (Figure 4C). Compared to a WT H99α x KN99a cross, RPL22a expression was overall lower, whereas that of RPL22α was higher (Figure S4A). Increased expression of RPL22α in the rdp1Δ mutant bilateral cross corroborates previous findings (Wang et al. 2010), although RPL22α expression seems to be indirectly regulated by RNAi because no sRNA map to the regions surrounding the RPL22α gene (Figure S5).
We also performed RT-qPCR during a bilateral cross between mutants for the SCANR complex component Gwc1, and found strong downregulation [fold change (FC) < 0.5)] of both RPL22a and RPL22α (Figure 4D; Figure S4B). Lastly, we used the recently developed CRISPR/Cas9 technology to accurately delete the MAT region in C. neoformans KN99a that is upstream of RPL22a and that is targeted by the abundant sRNA. The strain generated was named GI288 (5′Δ RPL22a), and a schematic representation of the strategy used is shown in Figure S6A. RT-qPCR expression analysis during mating revealed that RPL22a expression remained higher than RPL22α, except at 72 hr of incubation (Figure 4E). As compared to RPL22 expression during the WT cross, RPL22a was strongly downregulated in the GI228 (5′Δ RPL22a) × H99α cross at 48 and 72 hr of incubation, while expression of RPL22α remained unchanged (Figure S6B). Interestingly, expression of RPL22a during the GI288 (5′Δ RPL22a) × H99α cross mirrors that of RPL22a during the rdp1Δ bilateral cross, in accordance with an RNAi-dependent mechanism regulating RPL22a expression (Figure S6C). Despite the downregulation of RPL22a, the GI228 mutant strain does not display any morphological defect during vegetative growth, and its ability to mate with H99 and generate viable progeny was not compromised; as expected, genetic analysis of progeny derived from the GI228 × H99 cross showed cosegregation of NAT with MATa (data not shown).
RPL22 exchange allele strains exhibit sexual reproduction defects
We next sought to determine whether functional complementation of the RPL22 genes could be achieved by replacing either of them with the opposite RPL22 allele at the native locus within the MAT loci. To this end, we generated exchange alleles of RPL22α and RPL22a by means of CRISPR/Cas9, whose use was critical due to suppressed recombination within MAT. Because the RPL22 genes share a high level of identity (83%) (Figure S1), specificity of the gene replacement was achieved by designing two specific guide RNA (gRNA) molecules that determined the sites for homologous recombination. Transformation was performed by electroporation with the simultaneous introduction of the three gRNAs (at the 5′ and 3′ of the RPL22 gene, and one for SH2), the homology-directed repair (HDR) RPL22 gene, and selectable markers NAT or NEO, which were introduced in the SH2 region to avoid unnecessary ectopic mutations that could interfere with the resulting phenotype. Recipients for transformations were the most isogenic strains available for C. neoformans serotype A, H99 (MATα) and KN99a (MATa) (Nielsen et al. 2003; Janbon et al. 2014; Friedman et al. 2018).
In two independent transformation attempts, precise gene replacement of RPL22α with RPL22a at its native location within the MATα locus of H99 and correct integration of NAT in the SH2 were readily obtained. This resulted in the generation of rpl22α::RPL22a SH2::NAT mutant strains (YFF92) that differ from their parental strain only at the RPL22 gene. A schematic representation of the exchange strains generated is shown in Figure S7. Conversely, via the same strategy (i.e., two gRNA at the 5′ and 3′ of the RPL22) an RPL22a exchange allele strain could not be isolated. Because the RPL22 genes differ in only five amino acids that are located in the N-terminal region (Figure S1 and Figure S7), to replace RPL22a with the Rpl22α coding gene, a different strategy based on CRISPR/Cas9 was employed. In this approach, we generated a chimeric RPL22α (cRPL22α) HDR template, which consisted of the N-terminus of RPL22α fused with the C-terminus of RPL22a, and this was introduced into C. neoformans strain KN99a together with new gRNAs designed to target the 5′ region of RPL22a (Figure 5A; Figure S7). Several independent rpl22a::RPL22αN-RPL22aC SH2::NEO exchange strains were obtained, and one (strain YFF113) was chosen for further experiments. Allele exchange strains YFF92 and YFF113 were used in unilateral and bilateral crosses to evaluate both their MAT-specificity and the phenotypic consequence due to the absence of one RPL22 gene. In the presence of only RPL22a (cross KN99a × YFF92α) or RPL22α (cross H99α × YFF113a), the strains displayed no altered morphology and had WT mating ability, spore germination, independent segregation of the markers, and uniparental inheritance of mitochondria (Figure 5B; File S2; Table 3). These results indicate that the absence of one Rpl22 allele does not affect mating efficiency or meiosis when the other allele is present in the native location within MAT. Interestingly, RT-qPCR revealed a higher level of expression of the chimeric cRPL22α gene in the KN99a background compared to that of RPL22a in the H99 background at 72 and 96 hr of incubation, hence displaying the opposite trend compared with the WT cross (Figure 5D; Figure S8A).
Construction, analysis and sexual reproduction of RPL22 exchange strains. (A) Schematic representation of the generation of the C. neoformans RPL22 exchange strains YFF92 and YF113. Lightning bolts in different colors denote different gRNA targeting sites. (B) Mating phenotypes during crosses between H99α × KN99a, and YFF92 × KN99a, H99α × YFF113, and YFF92 × YFF113. Bar, 100 μm. (C) Genetic analysis of progeny obtained from the YFF92 × YFF113 bilateral cross; note the expected 1:1 segregation of the SH2::NAT and SH2::NEO markers in progeny produced from YFF92 × YFF113 cross, and the independent segregation of the MAT loci, with MATa indicated in gray and MATα indicated in white. (D) RT-qPCR of RPL22a and cRPL22α expression during the YFF92 × YFF113 cross. Asterisk indicates P < 0.05 for each cRPL22α and RPL22a comparison for the same day of incubation.
Genetic analysis of crosses between allele exchange strains
Because the approach utilized to generate strain YFF113 was successful, we employed the same gRNA to replace the RPL22a gene with a native copy of the RPL22α gene. After several unsuccessful attempts, we obtained one rpl22a::RPL22α strain (YFF116) with the NEO marker integrated ectopically in the genome, and not in the SH2 locus as planned (Figure 6A; Figure S7). Similar to findings presented above, in the presence of only the RPL22α gene (cross H99α × YFF116a), no morphological and genetic defects were observed (Figure 6C; File S2; Table 3). Remarkably, bilateral crosses of strains with exchanged RPL22 genes (YFF92α × YFF116a) exhibited a high percentage of irregular basidia (Figure 6D). High resolution scanning electron microscopy revealed that the majority of the basidia had no basidiospores, while others had a morphology defect (Figure 6, E and F; File S3), and a low number had irregular basidiospore chains collapsed on the basidia (Figure 6G; File S3). The formation of clamp connections was not affected (Figure 6H; File S3). Basidiospores germinated from cross YFF92α × YFF116a displayed a low germination rate (12%), and irregular segregation of the meiotic markers, with three progeny being MATa-RPL22α, no RPL22a-MATα progeny, and four progeny being both MATα and MATa, hence aneuploid or diploid (Table 3). RT-qPCR analysis during YFF92 x YFF116 mating revealed low expression (FC < 1) of both RPL22 genes from 24 to 96 hr (Figure 6B; Figure S8B).
Reciprocal RPL22 exchange strains exhibit defects in sexual reproduction. (A) Schematic representation of the generation of the C. neoformans RPL22 swapped strain YFF116. Lightning bolts in different colors denote different gRNA targeting sites. (B) RT-qPCR of RPL22a and RPL22α expression during YFF92 × YFF116 cross; asterisk indicates P < 0.05 for each cRPL22α and RPL22a comparison for the same day of incubation. (C and D) Mating phenotypes during crosses between the cross H99 × YFF116, and YFF92 × YFF116. Bar, 100 μm. (E) Scanning electron microscopy of sexual structures of the YFF92 × YFF116 cross; note that the majority of the basidia are bald with no basidiospore chains. Bar, 10 μm. (F) Scanning electron microscopy of an irregular basidium produced by the YFF92 x YFF116 cross. Bar, 10 μm. (G) Scanning electron microscopy of a basidium with a collapsed chain of basidiospores produced by the YFF92 × YFF116 cross. Bar, 1 μm. (H) Scanning electron microscopy of a regular unfused clump connection produced by the YFF92 × YFF116 cross. Bar, 1 μm.
To confirm that this defect was due to the rpl22a::RPL22α exchange allele, and to exclude any influence of the NEO marker, three NEOS MATa F1 progeny (SEC876, progeny 7; SEC884, progeny 15; SEC889, progeny 20; Table S1) obtained from the H99α × YFF116a cross were backcrossed with both H99α and YFF92α. Corroborating the results obtained with strain YFF116, progeny SEC876, SEC884, and SEC889 displayed normal mating with H99α, but, when crossed with the exchange allele strain YFF92, all three exhibited morphological defects remarkably similar to the YFF116 parent (Figure S10B).
Phenotypic analysis of rpl22 mutant strains
Heterozygous deletion mutants and exchange strains (Table S1) were tested for altered phenotypic traits (see Materials and Methods for details). Of the 28 stresses tested, few phenotypic differences among the isolates were observed on FLC, YP + NaCl, caffeine, and at 39° and 4° (Figure S9). Exchange strain YFF116 (rpl22a::RPL22α NEO) displayed sensitivity to hydroxyurea compared to its parental strain KN99a (Figure S9), but genetic analysis of the markers revealed that this was due to the ectopic integration of NEO (Figure S10A).
Discussion
A previous study reported that the MAT locus of C. neoformans contains five genes (RPL39, RPL22, MYO2, RPO41, and PRT1) that encode proteins required for viability (Fraser et al. 2004). The essential nature of these genes was inferred based on the inability to mutate them in a haploid strain of C. neoformans. In addition to C. neoformans, Candida albicans is the only other fungus known to encode essential genes within the MAT locus (Hull et al. 2000; Srikantha et al. 2012). It is likely that one function of MAT-essential genes is to limit recombination and serve as a genetic buffer constraining loss of portions of the MAT locus, although they might also serve other functions related to development, sexual reproduction, and virulence.
Here, the functions of the α and a MAT specific alleles encoding the C. neoformans ribosomal proteins Rpl22 and Rpl39 were characterized. Given suppressed recombination within the C. neoformans MAT loci, mutation of the RPL22 and RPL39 genes was challenging. Heterozygous mutants for these genes were successfully generated through the combined use of a biolistic split marker approach and the compound W7 to inhibit NHEJ and enhance homologous recombination (Fu et al. 2006; Arras and Fraser 2016). Through deletions in the C. neoformans a/α diploid strain AI187, and Mendelian analysis of recombinant F1 progeny obtained following sexual reproduction and spore dissection, we demonstrated that both the α and a alleles of the RPL22 and RPL39 genes are essential (Table 1; Figure 1). Conversely, in S. cerevisiae, the RPL22 and RPL39 orthologs are not required for viability (Steffen et al. 2012; Kim and Strich 2016), indicating evolutionary divergence of essential ribosomal genes between Ascomycetous and Basidiomycetous yeasts.
The ribosome was thought to be a constant, conserved, uniform protein translation machine. Recent studies have revealed novel and unexpected findings for the ribosome, in particular, complex heterogeneity and specialized activity that confers regulatory control in gene expression (Warner and McIntosh 2009; Narla and Ebert 2010; Xue and Barna 2012). While in mammals ribosomal proteins are encoded by single genes, in yeasts, plants, and flies, ribosomal proteins are encoded by several genes. A remarkable example is the model yeast S. cerevisiae, in which, following a genome duplication event, 59 of the 78 ribosomal proteins are encoded by two retained gene copies and share high sequence similarity, but are, in most cases, not functionally redundant, and have been found to play specialized functions (Xue and Barna 2012, and references therein). Specialized ribosomes have been identified also in plants, flies, zebrafish, and mice (Komili et al. 2007; McIntosh and Warner 2007; Xue and Barna 2012), but it is not known whether they exist in microbial pathogens.
A number of studies have converged to reveal diverse and specialized roles for the Rpl22 ribosomal paralogs in yeasts and vertebrates. In S. cerevisiae, haploid rpl22a mutants are cold sensitive, and display reduced invasive growth and a longer doubling time compared to rpl22b (Steffen et al. 2012; Kim and Strich 2016). Moreover, rpl22a mutations perturb bud site selection and cause random budding, while rpl22b mutations do not, and overexpression of RPL22B in rpl22a mutants fails to restore bud site selection (Komili et al. 2007). Vertebrates also express Rpl22 paralogs, called Rpl22 and Rpl22-like1 (RPL22-l1). Mice lacking RPL22 are viable, and have specific αβ T-cell developmental defects, likely attributable to compensation by Rpl22-l1 in other tissues (Anderson et al. 2007). Recent studies in both yeast and mammals suggest an extraribosomal role for Rpl22 paralogs in binding target mRNAs and regulating their expression (Gabunilas and Chanfreau 2016; Zhang et al. 2017; Abrhámová et al. 2018).
From an evolutionary viewpoint, it is important to highlight that in C. neoformans the RPL22 gene is present as a single copy, and it is not the result of a genome duplication event, in contrast to S. cerevisiae. Instead, the C. neoformans RPL22 gene was relocated to within the MAT locus concurrent with the transition from tetrapolar to bipolar, and, because of the suppressed recombination in this region, the two RPL22α and RPL22a alleles underwent a different evolutionary trajectory that generated differences between them (Coelho et al. 2017; Sun et al. 2017). Therefore, technically, they are alleles rather than paralogs. In this study, we sought to determine whether the Rpl22 MAT alleles play any specialized role in C. neoformans.
We found that RPL22α was not able to complement the essential phenotype due to mutations of RPL22a, whereas ectopic introduction of RPL22a in RPL22a/rpl22αΔ resulted in sporulation failure. Conversely, viability was restored in progeny derived from heterozygous RPL22a/rpl22αΔ + RPL22α and RPL22α/rpl22aΔ + RPL22a strains (Figure 3; Table 2). In a parallel approach, we inserted an RPL22 allele ectopically into a C. neoformans haploid strain, and then attempted to mutate the native opposite MAT copy. Also in this case deletion mutants could not be recovered, further supporting the observation of a failure of complementation between the two C. neoformans RPL22 alleles (data not shown). We further demonstrate that during both mitotic growth and sexual reproduction, RPL22a expression is much higher than RPL22α (Figure 4A; Figure S2). Considering that the heterozygous mutants RPL22a/rpl22αΔ and RPL22α/rpl22aΔ are viable, we propose two possible models to explain the lack of complementation. The first is a model involving an expression effect in which differential expression levels of the two RPL22 alleles at ectopic locations might hamper functional complementation; the second is a model involving position effect in which each RPL22 allele has to be in its own MAT locus.
We determined that an RNAi-mediated mechanism regulates RPL22a expression, and that it involves a region located upstream of RPL22a that includes the LTR11 and LTR14 elements and a predicted lncRNA; when this upstream region is silenced by sRNA, expression of RPL22a is enhanced. Conversely, in the absence of sRNA (i.e., in an RNAi mutant background), or when the sRNA-targeted region was deleted (Figure S6A), RPL22a expression was strongly decreased (Figure 4, B–E; Figure S4 and Figure S6). This is a novel and intriguing epigenetic mechanism of gene expression regulation within the MATa locus of C. neoformans. Examples of long terminal repeat (LTR) elements silenced by sRNA have been described also in plants and mammals as a mechanism of genome protection (Šurbanovski et al. 2016; Martinez et al. 2017; Schorn et al. 2017; Martinez 2018). There are also other locations within the MATa locus that are characterized by LTR elements that are also robustly targeted by sRNA in an RNAi-dependent manner (Figure 4B), and future studies will elucidate their impact on the gene expression, mating, and genome stability.
While we found differential expression between the RPL22a and RPL22α genes, and have identified epigenetic regulation of RPL22a expression, the approaches employed did not enable us to define whether the Rpl22 alleles play specific cellular roles. We then applied a newly developed CRISPR approach to generate haploid isogenic C. neoformans strains exchanging the MAT RPL22 genes: MATα-RPL22a (strain YFF92α) and MATa-RPL22α (strain YFF116a) (Figure S7). Unilateral crosses involving MATα-RPL22a × KN99a, and H99α × MATa-RPL22α, exhibited sexual reproduction features similar to the wild type cross H99α × KN99a, including dikaryotic hyphae, clamp connections, basidia, and basidiospore chains (Figure 5 and Figure 6; File S2). Conversely, the bilateral cross MATα-RPL22a × MATa-RPL22α (cross YFF92α × YFF116a) produced regular hyphae and clamp connections, but with irregular basidia, and few or no spores, which were characterized by a low germination and viability following microdissection, suggesting a defect in nuclear fusion, meiosis, or sporulation (Figure 6; File S3). This is likely due to the drastic reduction of both RPL22a and RPL22α expression (Figure 6B).
Lastly, we also generated a chimeric cRPL22α-MATa (YFF113) exchange strain of C. neoformans to initially test the phenotypic consequences of exchanging Rpl22, with a focus on the five amino acid differences located in the N-terminal region of the protein (Figure 5; Figure S7). While this exchange strain does not display any morphological or phenotypic defects (Figure 5; Figure S9), its analysis turned out to be of interest with respect to the mechanisms of regulation of RPL22α. The strains MATa-cRPL22α (YFF113) and MATa-RPL22α (YFF116) both encode an Rpl22α protein, yet they display very different RPL22 expression patterns and distinct phenotypes (Figure S8C; Figure S9). In S. cerevisiae, introns play a crucial role in RPL22 expression, with Rpl22 playing an extraribosomal role in inhibiting the splicing of the RPL22B pre-mRNA transcript through direct binding of its intron (Gabunilas and Chanfreau 2016; Abrhámová et al. 2018). Moreover, this mechanism of autoregulation seems to be conserved also in Kluyveromyces lactis, a Saccharomycotina species that did not undergo the whole genome duplication event, and retains only one copy of the RPL22 gene (Scannell et al. 2007). Similar mechanisms might operate to control expression of C. neoformans RPL22α. Considering the high expression of the chimeric cRPL22α, but not RPL22α (Figure S8C), one could hypothesize that their different introns could potentially have a regulatory role in RPL22α expression. The two Rpl22α-coding genes in strains MATa-cRPL22α (YFF113) and MATa-RPL22α (YFF116) differ only in the 3′ region, which, for strain YFF113, is from RPL22a and includes introns 2 and 3. Intron 1, which is the largest and most divergent between the RPL22 genes (Figure 2; Figure S7 and Figure S11), is the same in the RPL22α and cRPL22α allele, and can, therefore, be excluded. Introns 2 of RPL22a and RPL22α share high sequence similarities, and have the same intronic features (Figure 2; Figure S11). Introns 3 share lower sequence similarities, and the main differences are found in pre-mRNA secondary structure and nucleotide composition in the region between the branch site location and the 3′ acceptor site (Figure 2; Figure S11), which is known to affect splicing and gene expression (Gahura et al. 2011; Plass et al. 2012; Zafrir and Tuller 2015). Furthermore, another issue could also be that the canonical branch site of intron 3 of RPL22α might be too close to the donor site with inhibition of the lariat formation, while intron 3 of RPL22a has a possible more distal canonical branch site (Figure 2). Based on these observations, we speculate that intron 3 of RPL22α might be a candidate for regulatory function.
Our findings, such as the absence of morphological defects of heterozygous RPL22/rpl22 mutants, the lack of cross complementation between the RPL22 alleles, and the morphological and genetic defect of exchange strain MATa-RPL22α, may support a model in which the two RPL22 MAT essential genes operate as a type of imprinting system to ensure fidelity of sexual reproduction to enforce coordinate segregation of the opposite MAT nuclei in the dikaryotic hyphae.
Acknowledgments
We thank Alexander Idnurm for critical comments on the manuscript. This work was supported by National Institutes of Health/ National Institute of Allergy and Infectious Diseases (NIH/NIAID) R01 grant AI50113-15 and by NIH/NIAID R37 MERIT award AI39115-21 (to J.H.) and grant KU 517/ 15-1 (U.K.) from the German Research Foundation (DFG). Joseph Heitman is Co-Director and Fellow of the CIFAR program “Fungal Kingdom: Treats and Opportunities”.
Footnotes
Supplemental material available at figshare: https://doi.org/10.25386/genetics.11440986.
Communicating editor: N. L. Glass
- Received September 19, 2019.
- Accepted December 21, 2019.
- Copyright © 2020 by the Genetics Society of America
