Abstract
Maintenance of genome integrity is a crucial cellular focus that involves a wide variety of proteins functioning in multiple processes. Defects in many different pathways can result in genome instability, a hallmark of cancer. Utilizing a diploid Saccharomyces cerevisiae model, we previously reported a collection of gene mutations that affect genome stability in a haploinsufficient state. In this work we explore the effect of gene dosage on genome instability for one of these genes and its paralog; SAM1 and SAM2. These genes encode S-Adenosylmethionine (AdoMet) synthetases, responsible for the creation of AdoMet from methionine and ATP. AdoMet is the universal methyl donor for methylation reactions and is essential for cell viability. It is the second most used cellular enzyme substrate and is exceptionally well-conserved through evolution. Mammalian cells express three genes, MAT1A, MAT2A, and MAT2B, with distinct expression profiles and functions. Alterations to these AdoMet synthetase genes, and AdoMet levels, are found in many cancers, making them a popular target for therapeutic intervention. However, significant variance in these alterations are found in different tumor types, with the cellular consequences of the variation still unknown. By studying this pathway in the yeast system, we demonstrate that losses of SAM1 and SAM2 have different effects on genome stability through distinctive effects on gene expression and AdoMet levels, and ultimately separate effects on the methyl cycle. Thus, this study provides insight into the mechanisms by which differential expression of the SAM genes have cellular consequences that affect genome instability.
- cancer biology
- genomic instability
- S-adenosylmethionine (AdoMet)
- Saccharomyces cerevisiae
- yeast genetics
CHROMOSOMAL instability was originally proposed to play a role in tumor development more than a century ago (Boveri 2008). Since that time aneuploidy, characterized by deviation from the euploid chromosome number, has been observed in a majority of human cancer cells (Sansregret and Swanton 2017). Studies utilizing the budding yeast Saccharomyces cerevisiae have established that missegregation of even a single chromosome is sufficient to induce further genomic instability, resulting in additional chromosomal instability, mutagenesis, and sensitivity to genotoxic stress (Sheltzer et al. 2011). Cells must balance the dual needs of genome maintenance and environmental adaptation. Increases in genome instability can enable accumulation of favorable genotypes but also allow premalignant cells to more rapidly acquire the biological hallmarks of cancer (Hanahan and Weinberg 2011). The cellular processes that ensure genome stability are highly conserved from yeast to humans (Skoneczna et al. 2015), allowing chromosomal instability and genome instability findings in yeast to be directly applied to hypotheses about human malignancy and predictions of novel therapeutic targets.
Previously, we used diploid S. cerevisiae to screen for heterozygous mutations able to modify genome instability. A strain deleted for one of the S-adenosylmethionine (AdoMet) synthetase genes demonstrated a haploinsufficient effect on genome instability, indicating the human homolog could be a potential cancer predisposition gene (Strome et al. 2008). Sam1 and its paralog Sam2 play roles in the methyl cycle (Figure 1); catalyzing the biosynthesis of AdoMet by transfer of the adenosyl moiety of ATP to the sulfur atom of methionine (Chiang and Cantoni 1977). The two AdoMet synthetase genes, SAM1 and SAM2, in S. cerevisiae are paralogs arising from the whole-genome duplication (Cherest and Surdin-Kerjan 1978). While cells remain viable after the deletion of either SAM1 or SAM2, the double homozygous deletion of both genes is lethal unless growth medium is supplemented with AdoMet (Thomas and Surdin-Kerjan 1997). These two genes share 83% identity between their open reading frames and 92% identity between protein sequences (Thomas et al. 1988). Despite this high level of homology and findings that GFP-tagged versions of both proteins localize to the cytoplasm (Huh et al. 2003), differences in the abundance of each protein (Ghaemmaghami et al. 2003) and in the regulation of expression have been found. SAM2 is subject to inositol-choline regulation (Kodaki et al. 2003) and induced by the addition of excess methionine (Thomas et al. 1988); conversely, SAM1 is unresponsive to inositol-choline and repressed by excess methionine. Further, proteome studies on post-translational modifications of the Sam1 and Sam2 proteins indicate these proteins vary in the number of sites that are modified and the types of modifications that occur (ubiquitin, succinyl, acetyl, and phosphate groups) (Peng et al. 2003; Holt et al. 2009; Henriksen et al. 2012; Swaney et al. 2013; Weinert et al. 2013). These findings speak to the differential regulation and use of these proteins by the cell.
The methyl cycle in the yeast Saccharomyces cerevisiae. AdoMet functions in three main metabolic pathways from the methyl cycle: transmethylation, transsulfuration, and aminopropylation. Transmethylation reactions are catalyzed by methyltransferases, which transfer the methyl group from AdoMet to a wide range of acceptor molecules. The transfer of the methyl group from AdoMet leaves S-adenosylhomocysteine (AdoHcy) as a byproduct. AdoHcy is converted to adenosine and homocysteine (Hcy) via the enzyme adenosylhomocysteinase. This reaction occurs only if adenosine and Hcy levels are low, which the cell must balance to prevent buildup of AdoHcy and therefore the prevention of AdoMet-dependent methylation reactions. Methionine can be regenerated by methylation of Hcy via methionine synthase (MS). Remethylation via MS requires products of the folate cycle, specifically 5-methyltetrahydrofolate (5-MTHF), which is then converted to THF when it loses its methyl group. The folate cycle is required for dNTP production, specifically dTTPs, and therefore correct balance of dNTPs. Furthermore, dNTP pool size is monitored by dATP/ATP ratios. As AdoMet, produced from ATP and methionine, is the second most used enzyme substrate (behind ATP); deviations in its production could alter ATP ratios (if ATP is not converted to AdoMet due to lack of AdoMet synthetases) and further disrupt appropriate dNTP production. The conversion of Hcy to cysteine is a two-step reaction with the production of cystathionine as an intermediate. This requires two enzymes cystathionine β-synthase, and cystathionine γ-lyase. Cysteine is the rate-limiting precursor to glutathione (GSH) synthesis. GSH, used with glutathione-S-transferases (GSTs), are a major oxidative species sink used by cells to prevent DNA and protein reaction with reactive oxygen species. AdoMet decarboxylase, decarboxylates AdoMet to then enter the polyamine synthesis pathway. Polyamines are low-molecular-weight, positively charged molecules that include spermidine and spermine, with known roles in growth and apoptosis.
As a cellular enzyme substrate, the use of AdoMet is second only to ATP, and it is the methyl donor for the predominance of methylation reactions in all organisms (Cantoni 1975; Chiang et al. 1996) In S. cerevisiae this includes methylation of proteins, RNAs, lipids, and other small molecules. Beyond this role in transmethylation, AdoMet’s extreme versatility allows it to function in additional metabolic pathways such as transsulfuration and aminopropylation (Figure 1). One of the metabolic products of AdoMet is homocysteine from which glutathione (GSH) can be generated via the transsulfuration pathway and additional reactions (Tehlivets et al. 2013). GSH is used as an electrophilic acceptor by glutathione-S-transferases (GSTs), which are important for preventing cellular damage caused by reactive oxygen species [reviewed in Hayes and Pulford (1995), Whalen and Boyer (1998), Strange et al. (2001)]. AdoMet is also used in the synthesis of polyamines such as spermidine and spermine, which are involved in cell growth (Bottiglieri 2002). Additionally, AdoMet functions as a regulator of sulfur amino acid metabolism (Blaiseau et al. 1997) and as a donor of other constituents such as amino groups (in the formation of biotin), ribosyl groups, and 5′ deoxyadenosyl radicals (Carman and Henry 1989; Slany et al. 1993; Thomas and Surdin-Kerjan 1997; Phalip et al. 1999; Chattopadhyay et al. 2006; Tehlivets et al. 2013).
As in all organisms studied to date, humans have genes encoding methionine adenosyl transferases (MATs), also known as AdoMet synthetases. In humans, however, the formation of these AdoMet synthetase isozymes occurs differently. Three genes, MAT1A, MAT2A, and MAT2B, each encode a catalytic or regulatory subunit used in formation of the MATI (homotetramer), MATII (heterotrimer), and MATIII (homodimer) isozymes (Martínez-Chantar et al. 2002). The SAM1 and SAM2 genes in S. cerevisiae are homologous to the MAT2A gene in Homo sapiens (Mato and Lu 2007). MAT2A and SAM1 share 63.5% nucleotide sequence and 68.2% protein sequence similarity, while MAT2A and SAM2 share 64.1% nucleotide sequence and 67.8% protein sequence similarity. MAT1A is expressed only in adult liver, while MAT2A and MAT2B are expressed in fetal liver and nonhepatic tissues. These genes, and their product AdoMet, have been implicated in multiple cancer types, but the mechanism of action is not well understood, and upregulation is found in some cancers while downregulation is found in others (Martínez-Chantar et al. 2002; Kodaki et al. 2003; Chen et al. 2007; Greenberg et al. 2007; Mato and Lu 2007; Liu et al. 2011; Zhang et al. 2013; Wang et al. 2014; Ilisso et al. 2016; Phuong et al. 2016).
Our studies of SAM gene dosage add to this area of investigation by documenting the effects of changes in AdoMet synthetase genes on genome stability. These findings help us understand the differences in the roles of the unlinked SAM1 and SAM2 genes in a diploid S. cerevisiae system and how altered expression of the homologous genes in humans may affect cancer development.
Materials and Methods
Strains
Our parental strain (hereafter referred to as wild type) genotype is: MAT a/α, leu2-3/leu2-3 his3-Δ200/his3-Δ200 trp1-Δ1/trp1-Δ1 lys2-801/LYS2 ura3-52/ura3-52 can1-100/CAN1 ade2-101/ade2-101 2× [CF:(ura3::TRP1, SUP11, CEN4, D8B)]. A rad9-deficient strain, rad9Δ/rad9Δ, was created by the insertion of a HIS3 cassette into both RAD9 loci of the wild-type strain. The SAM gene deletions were created utilizing the homologous recombination switch-out method (Wach et al. 1994). The sam1::KANMX cassette was PCR-amplified from the yeast heterozygous gene deletion collection (YSC1055; Dharmacon) with primers 500–800 bp upstream and downstream from the SAM1 open reading frame. The sam2::LEU2 cassette was created using a two-step PCR reaction with primers 300–800 bp upstream and downstream, replacing the SAM2 open reading frame with the LEU2 gene. The PCR generated products were transformed into our wild-type and rad9Δ/rad9Δ diploids to create SAM heterozygotes. Appropriate haploids, derived from the wild-type and rad9Δ/rad9Δ diploids, of opposite mating type, were transformed with SAM knockout cassettes and mated to create SAM1/SAM2 deletion combinations and homozygous deletion strains. Transformants were selected on appropriate media and cassette integration at the correct location was verified via PCR. Later addition of a HPHMX cassette to appropriate haploids to ensure addition to the opposite arm of chromosome V from the location of the CAN1 gene allowed for further genome instability assays. A complete listing of strains and their genotypes can be found in Supplemental Material, Table S1.
Chromosome transmission fidelity assay for sectoring
Each strain was struck for individual colony formation on low-adenine concentration (6 μg/ml) synthetic complete (SC) plates and allowed to grow at 30° for 7 days, followed by overnight incubation at 4° for color development. Colonies were examined for the appearance of pink/red sectors. Two trials were completed for each strain with a minimum of 600 individual colonies examined per trial. The chromosome fragment and assay are described in more detail in Spencer et al. (1990), Strome et al. (2008), Duffy and Hieter (2018). Fold change in the chromosome transmission fidelity (CTF) rate of each mutant compared to the appropriate-parental strain was calculated. A Student’s t-test was performed, individually comparing each mutant strain to the parental, to identify mutant strains with significantly different CTF rates. Assays for CTF rates in the presence of AdoMet supplementation were carried out as above, with the addition of 60 μM of AdoMet (NEB B9003S) to the SC-low adenine plates.
Chromosome V instability rate assays
Cells were grown at 30° on appropriate selection media, allowing genome instability events to occur, until individual colonies reached ∼3 mm. Twenty-four individual colonies per strain were each dispersed in 200 μl of water in a 96-well plate. Absorbance was measured at 562 nm (ELx800; BioTek) and the 15 colonies with the most similar optical densities (reflecting similar population size) >0.8 were used for analysis. The numbers of viable and canavanine-resistant cells were determined by plating dilutions on nonselective (YPD) and SC-Arg− plus canavanine (60 μg/ml) (C9758; Sigma-Aldrich) plates, respectively. Plates were grown for 3–5 days at 30°, followed by colony counting. The fluctuation analysis-based chromosome V instability rate and 95% confidence intervals (95% CIs) were calculated utilizing the R advanced calculation package Salvador (rSalvador), taking plating dilution into account (Zheng 2002, 2008, 2016). The 95% CI overlap method mimics a two-tailed, two-population t-test at the conventional P < 0.05 level with an improvement in type 1 error rate and statistical power when compared to a t-test, which has been found unsuitable for fluctuation data analysis (Zheng 2015). The placement of the hygromycin (HPHMX) resistance cassette on the opposite arm of chromosome V, but on the same parental chromosome as the CAN1 allele, allows for the differentiation of local events from full chromosome events. Cells from colonies that grew on canavanine plates were struck to hygromycin plates (300 μg/ml) (VWR K547) and scored for growth. Chromosome V instability rates and confidence intervals were measured for a minimum of two biological replicates for each strain. Assays for chromosome V instability rates in the presence of AdoMet supplementation were carried out as above, with the addition of 60 μM of AdoMet to the media during the initial growth phase when instability events would occur. Assay for CAN1 mutation rate in haploids was again calculated using fluctuation analysis methods as above and the rSalvador package was utilized for mutation rate estimation and 95% CI calculations.
RT-PCR:
RNA extraction:
Three-milliliter cultures were grown shaking at 30° overnight, and then 1.5 ml of the culture was pelleted at 20,000 rpm for 1 min, and the supernatant was discarded. Next, 750 μl TRIzol (Ambion) and ∼200 μl glass microbeads (425–600 μm; Sigma-Aldrich) were added and cells were homogenized for cycles of 15, 25, and 15 sec (BioSpec Mini-BeadBeater-8) with a 5 min rest on ice between each homogenization. Samples were incubated at room temperature (RT) for 5 min, 150 μl chloroform (Fisher Scientific) was added and vigorous shaking to mix was carried out for 15 sec, followed by RT incubation for 3 min and centrifugation at 12,000 × g for 15 min at 4°. Next, 375 μl isopropanol was added to the aqueous phase and mixed by inversion, followed by a RT incubation for 10 min and centrifugation at 12,000 × g for 10 min at 4°. The supernatant was removed, and the RNA pellet was washed with 750 μl 75% ethanol, followed by centrifugation at 7500 × g for 5 min at 4°. The supernatant was again removed, the pellet was air dried at RT for 10 min, resuspended in 20 μl RNase-free water, and then incubated at 55° for 10 min. The RNA was used immediately for complementary DNA (cDNA) synthesis.
cDNA synthesis:
cDNA was synthesized using the Verso cDNA synthesis kit (Thermo Scientific) following the manufacturer’s instructions for 20 μl reactions, using 1 μg RNA and 1 µl of a 3:1 (v/v) primer blend of random hexamer:anchored oligo(dT). cDNA was stored on ice and then added into the RT-PCR set-up within the same day.
RT-PCR:
RT-PCR was performed using the DyNAmo Flash SYBR Green qPCR kit (Thermo Fisher). Each 20 μl reaction contained 1.2 μl of 5 μM forward primer, 1.2 μl of 5 μM reverse primer, 10 μl of 2× master mix, 0.4 μl of ROX, 2 μl of cDNA template, and 5.2 μl of nuclease-free water. Each reaction had a technical replicate in the same 96-well plate. A minimum of three biological replicates were tested per strain. The reaction was cycled 40 times as directed by the manufacturer with a 15 sec denaturation and 1 min extension periods (7300 RT-PCR system; Applied Biosystems). Ct data were analyzed using the 2009 REST software (http://rest-2009.gene-quantification.info) in standard mode. For each strain the data were normalized to TUB1 and ACT1 and expression was compared to the parental strain. The following primers were used for amplification in each strain: SAM1FW AATTACTACCAAGGCACAGT, SAM1RV ATCCTTCTCCTCGTGGACAC, SAM2FW AATTACCACCAAAGCTAGAC, SAM2RV GCTCTTTTCATAGTGCAGAC, TUB1FW CCAAGGGCTATTTACGTGGA, TUB1RV GGTGTAATGGCCTCTTGCAT, ACT1FW TTCAACGTTCCAGCCTTCTAC, and ACT1RV ACCAGCGTAAATTGGAACGAC.
Ultraperformance liquid chromatography mass spectrometry analysis:
Strains were grown to saturation at 30° in 3 ml selective media followed by a 1:1000 dilution into 200 ml of the same media. Cells were then grown shaking at 30° to log phase as measured by an OD600 of 0.5–0.8 (Genesys20; Thermo Scientific), centrifuged at 2500 rpm for 2 min to pellet cells, then stored at −80°. Cell pellets were thawed on ice and resuspended in residual liquid. A portion of the pellet (300 μl) was moved to a clean microcentrifuge tube and spun at 20,000 rpm for 1 min. Any excess liquid was removed and the pellet was weighed. Cells were added or removed until the cell pellets weighed between 100 and 160 mg. Then, 350 μl of freshly prepared, cold 25:75 autoclaved, distilled H2O:Acetonitrile (HPLC grade; Fisher Scientific) and ∼200 μl glass microbeads were added and cells were homogenized (BioSpec Mini-BeadBeater-8) for 30 sec followed by a 5 min rest on ice. The homogenization and ice incubation were repeated two additional times. The microcentrifuge tube was then pierced on the bottom, stacked into a fresh microcentrifuge tube, and both were centrifuged at 1000 rpm for 1 min. The upper tube containing glass beads was discarded while the lower tube was centrifuged at 20,000 rpm for 5 min to pellet any residual debris. The supernatant was syringe filtered (0.22 μm PVDF; Restek) into a LC/GC certified glass vial (186000384c; Waters, Milford, MA) and stored at 4°, then analyzed within 24 hr. Samples were diluted into the 25:75 H2O:Acetonitrile diluent and 1 μl injected for analysis. Analysis of the extract was performed by ultraperformance liquid chromatography mass spectrometry; the system consisted of an Acquity HClass and QDa Mass Detector (Waters Corporation). The sample compartment was maintained at 10°. The mass detector (QDa) was operated in electrospray positive mode with a capillary voltage of 0.8 V and probe temperature of 500°. Analysis of the AdoMet was done by monitoring the protonated molecular ion (M+H+) at mass 399 in selected ion recording mode. Separation of the compound was done using an Amide column (BEH Amide column, 2.1 × 50 mm; Waters Corporation) at 45°. A hydrophilic interaction liquid chromatography (HILIC) separation method used a gradient of ammonium acetate, formic acid, and acetonitrile at a flow rate of 0.5 ml/min was used. AdoMet eluted at 2.5 min in the 5 min analysis. A calibration curve was generated by injecting 1 μl of eight AdoMet standards (32 mM; New England Biolabs) in 25:75 H2O:Acetonitrile from a concentration of 2–100 μg/ml, resulting in a correlation coefficient (r2) of 0.994 on an eight-point curve. AdoMet concentrations for each strain were individually compared to the appropriate parental strain and a Student’s t-test was performed to identify mutant strains with significantly different AdoMet pools.
Morphology:
Strains were grown overnight to log phase in appropriate selection media. Aliquots were sonicated to remove cell clumping and counted on a hemocytometer. Images of at least five separate fields of cells were taken. Length and width measurements were analyzed for 100 cells per strain using Image Quant to determine mother cell size, bud size, and elongation. One-way ANOVA for comparison of the sizes and elongations between strains was performed and residual plots were checked for goodness of fit, indicating ANOVA was the correct model to use. Pairwise comparisons between mutant strains and the parental were done using the Tukey–Kramer adjustment for multiple comparisons. In assessing bud size, a bud is scored as small if it is one-third the size of the mother, or smaller; medium if it is larger than one-third and smaller than two-thirds the size of the mother; and large if it is two-thirds the size of the mother, or larger. A chi-square test for the difference of the distribution of bud size was conducted and the Pearson P-value is reported.
Genotoxic stress assays:
Cells were grown overnight in selection media in a 96-well plate at 30°, diluted to 0.2 OD, and allowed to grow back for 3–4 hr to log phase range (0.5–0.8 OD). Absorbance was measured at 562 nm (ELx800; BioTek). Cells were then washed and used to create a fivefold serial dilution in water across six wells and stamped in duplicate on the genotoxic stress plates. Plates were incubated at 30° for 3 days. Genotoxic stressors tested were as follows: ultraviolet light (UV) at 17.5, 35, and 70 J/m2; hydroxyurea (HU) at 50, 75, and 100 mM; phleomycin at 0.5, 1, and 6 μg/ml; and benomyl at 10, 20, and 30 μg/ml.
Data availability
Strains are available upon request. File S1 includes all strain genotype information. The authors affirm that all data necessary for confirming the conclusions of the article are present within the article, figures, and tables. Supplemental material available at FigShare: https://doi.org/10.25386/genetics.8949467.
Results
SAM1 and SAM2 deletions have different dosage effects on genome instability
To determine the effect of SAM gene dosage on one form of genome instability, we performed the CTF assay (Spencer et al. 1990), which monitors the inheritance of an artificial chromosome fragment. Briefly, our diploid strains are homozygous for the ade2-101 allele, which prevents completion of the adenine biosynthesis pathway and leads to the development of a red pigment. Our strains also carry two chromosome fragments that harbor the SUP11 ochre suppressor, enabling full adenine synthesis and normal coloration. If cells lose one or both of their chromosome fragments during the growth of a colony, the cells develop a pink or red color, respectively, and they and their progeny can be visualized as a pie-shaped sector portion of the colony. This assay identified that the complete loss of sam2 (sam2Δ/sam2Δ and sam1Δ/SAM1 sam2Δ/sam2Δ strains) significantly increases CTF rates (Table 1). Further, when this assay is performed in the presence of exogenous AdoMet in the media, these significant increases in loss of the chromosome fragment are suppressed.
Our second genomic instability assay monitors the CAN1 locus on chromosome V and uses fluctuation analysis (Luria and Delbrück 1943; Lea and Coulson 1949) to estimate a genome instability rate. Our diploid strains contain a wild-type CAN1 gene, conferring sensitivity to canavanine, and a recessive allele can1-100, conferring resistance. This assay quantitates conversion to canavanine resistance (CanR; as instability events per cell per generation), which could occur through a variety of genome instability mechanisms such as deletions, chromosome loss events, mutations, or recombination. This assay expands our measure of genome instability from the previous CTF assay as it both measures events occurring on an endogenous chromosome and also accounts for a broad range of the types of instability that have the capacity to affect cancer development. Chromosome V instability was measured using a modification of the method described previously (Klein 2001; Strome et al. 2008). The 95% CI was calculated using rSalvador. Strains, with nonoverlapping CIs with parental chromosome V instability rates, harbor deletions that result in statistically significant changes in genome instability compared to the parental strain. Full sam2 loss, as well as heterozygous loss alone, results in statistically significant increases in chromosome V instability [strains sam2Δ/SAM2, sam2Δ/sam2Δ, and sam1Δ/SAM1 sam2Δ/sam2Δ (Figure 2A)], whereas loss of sam1, either heterozygously or homozygously, while SAM2 is intact, confers a protective effect on the genome, significantly decreasing instability. Because of sam1 and sam2 mutations inducing opposite effects on instability, it is not surprising to see that strains that harbor mutations in both genes have intermediate effects. Strains heterozygous for one of these genes and homozygous for the other, show chromosome V instability rates that trend toward the effect observed for the homozygously mutated gene. That is, in the sam1Δ/SAM1 sam2Δ/sam2Δ strain, instability is increased but not to the same level as sam2 mutation alone, whereas the sam1Δ/sam1Δ sam2Δ/SAM2 strain displays a near wild-type level of instability with only a trend toward stability, likely due to the full loss of sam1.
Chromosome V instability rates in SAM mutants alone and with AdoMet Supplement. The data shown represents a combination of a minimum of two independent experiments. (A) The black circle depicts the mean instability rate (instability events/cell/generation) with the tails showing the experimental 95% confidence intervals (95% CI). The gray bar represents the 95% CI of the parental strain. Those SAM mutant strains with a non-overlapping 95% CI, to the parental strain, are considered significantly different from the parental. (B) Mean instability rates (pink square) of all strains grown with exogenous AdoMet. Tails represent the experimental 95% CIs. The pink bar represents the 95% CI of the parental strain grown with AdoMet supplementation. Black circles and tails are the same as in (A) and are overlaid to aid in viewing changes.
When this assay is performed in the presence of exogenous AdoMet, many but not all, of these instability effects are suppressed (Figure 2B). The stability conferred due to the heterozygous sam1Δ/SAM1 deletion alone is fully suppressed with instability rates returning to wild-type levels. However, the stabilizing effect of full homozygous deletion of sam1 is not repressed and stays at the same level as untreated. This indicates that the Sam1 protein (Sam1p) is required for the suppression effects of supplemental AdoMet addition.
As the chromosome V instability assay to CanR measures multiple types of genome instability without distinguishing between mechanisms we created additional strains to differentiate and provide a more complete analysis. First, haploid CAN1 mutation analysis was assessed in wild-type, sam1Δ, and sam2Δ strains to understand the role of the loss of these genes on spontaneous mutation rate. Previous work has shown that the mutations responsible for change to CanR in haploid yeast most frequently occur via point mutations: transversions, transitions, frameshift changes, and small scale (< ∼100 bp) duplications and deletions (Holbeck and Strathern 1997; Tishkoff et al. 1997; Ohnishi et al. 2004). No change in the rate of conversion to CanR was observed, compared to the parental strain, in either mutant (Table 2). This indicates the solo loss of either of these genes does not alter the rate of point mutations, or their repair, in the haploid system. Second, to better distinguish among the loss of heterozygosity mechanisms that could account for the changes to CanR in our diploid strains, we recreated all of our strains with a hygromycin resistance marker on the opposite arm from CAN1, on chromosome V. When we then assay for conversion to CanR, colonies are further assessed for their hygromycin sensitivity (HphS) or resistance (HphR). Colonies that are CanR HphR represent instability events affecting only one arm of chromosome V, such as point mutations, gene conversion, and mitotic recombination events. CanR HphS colonies most likely arise from full chromosome V loss events, with or without reduplication. For almost all CanR colonies tested, the HphR cassette was maintained, indicating instability occurred via partial chromosome affecting events, which in yeast most frequently occur due to allelic mitotic recombination (Klein 2001) (Table 3). No statistically significant difference between strains and the parental were found. These two additional assays taken together indicate that sam1 and sam2 mutations alter genome stability primarily through their alteration of mitotic recombination events and not via point mutations or full chromosome loss events. Although inconsistency is noted in full sam2Δ/sam2Δ deletant strains, which increased CTF loss rates, indicating that for a smaller, artificial chromosomal fragment, loss events do increase due to loss of sam2.
Genome instability increases due to loss of SAM2 are absent in an RAD9 DNA damage checkpoint-deficient background
To gain further insight into the relationship between various SAM gene deletions and genome instability, we performed our chromosome V instability experiments in strains lacking the RAD9-dependent DNA damage checkpoint (Figure 3A, Table 2, and Table 3). Rad9 is involved in sensing and responding to DNA damage, is required for checkpoint-induced cell cycle arrest due to damage in all phases of the cell cycle, and loss is sufficient to increase genome instability on its own (Weinert and Hartwell 1988, 1989, 1990; Al-Moghrabi et al. 2001; Toh and Lowndes 2003). Full loss of SAM1 continues to confer a protective effect and reduces the level of instability seen due to the rad9Δ/rad9Δ deletion alone (Figure 3A). Addition of exogenous AdoMet again fails to have a substantial effect, and strains remain with decreased genome instability (Figure 3B). However, in strains lacking SAM2 and this checkpoint, no increase in instability is observed beyond the level induced by the rad9Δ/rad9Δ deletion alone. In fact it appears that the genome-stabilizing effects due to SAM1 deletions are more readily seen in this background as strains harboring mutations in both SAM1 and SAM2 now show lower rates of instability compared to the rad9Δ/rad9Δ parental. The effects due to loss of SAM1 may be more apparent as the effects of SAM2 mutation on genome stability are already absorbed in the RAD9 loss.
Chromosome V instability rates in rad9-deficient SAM mutants alone and with AdoMet Supplement. The data shown represents a combination of a minimum of two independent experiments. (A) The black circle depicts the mean instability rate (events/cell/generation) with the tails showing the experimental 95% confidence intervals (CI). The gray bar represents the 95% CI of the parental strain. Those SAM mutant strains with a non-overlapping 95% CI, to the rad9-deficient parental strain, are considered significantly different. (B) Mean instability rates (pink squares) of all strains grown with exogenous AdoMet. Tails represent the experimental 95% CIs. The pink bar represents the 95% CI of the rad9-deficient parental strain grown with AdoMet supplementation. Black circles and tails are the same as in part (A) and are overlaid to aid in viewing changes.
We again sought to more completely characterize the types of instability contributing to the rates of conversion to CanR. Haploid CAN1 mutation analysis was assessed in rad9Δ, sam1Δ rad9Δ, and sam2Δ rad9Δ strains to characterize the effects of combination of these mutants on point mutation rate. No change in the rate of conversion to CanR was observed in the double mutants, compared to the rad9Δ strain (Table 2), indicating that again loss of neither of these genes alters the rate of point mutations, or their repair, in the haploid system. We then characterized the portion of CanR that occurred via loss or mitotic recombination events in the rad9-deficient background. While a slight increase in loss events was noted due to the rad9Δ/rad9Δ alone, adding SAM gene mutations did not statistically significantly alter the rate, with most events still occurring through mitotic recombination (Table 3). Therefore while the instability rates change in the presence of the rad9-deficiency, the types of instability events that make up that rate are not significantly different.
SAM1 and SAM2 demonstrate dosage-sensitive expression profiles, and differentially affect expression of each other
Genome instability data indicates different roles for the SAM1 and SAM2 genes (with further alterations seen in a rad9-deficient background), and previous work has shown these genes have different inducers and repressors (Thomas et al. 1988; Kodaki et al. 2003). We therefore wanted to characterize how our gene deletions affected SAM gene expression levels by performing quantitative RT-PCR for both SAM1 and SAM2 in each strain. Levels of expression in the wild-type and rad9Δ/rad9Δ strains were used as the control parental levels for the respective set of strains and expression is displayed as the fold increase or decrease compared to that level (Figure 4, A and B). As expected, the heterozygous deletion of one gene resulted in reduced expression of that gene while the homozygous deletion of the gene resulted in no expression of that gene. In a wild-type background in the absence of sam1, SAM2 expression is at its highest measured value in any strain (Figure 4A). These results are in line with previous work reporting that SAM2 expression increases in response to excess methionine (Holbeck and Strathern 1997; Tishkoff et al. 1997; Ohnishi et al. 2004). The sam1 deletions, resulting in decreased AdoMet synthetase production from this locus, likely result in an increase in methionine. This increase in methionine could then be enough to induce increased expression from the SAM2 locus (Thomas et al. 1988), resulting in the increased mRNA expression detected. Indeed, in the sam1Δ/sam1Δ sam2Δ/SAM2 strain the expression of SAM2 is not reduced to the level seen in the sam2Δ/SAM2 single mutant (Figure 4A). This is likely the effect of the sam1 homozygous deletion leading to excess methionine and increased SAM2 expression. Conversely, those strains homozygously deleted for sam2, either alone or in combination with sam1 deletions, resulted in a significant reduction in the expression of SAM1 (Figure 4A). In this case, the increase in methionine due to the reduction in AdoMet synthetase expression, leads to significant repression of SAM1 expression, as previously described (Thomas et al. 1988).
Changes in SAM1 and SAM2 expression. A quantitative RT-PCR analysis of SAM1 (gray) and SAM2 (pink) gene expression normalized to ACT1 and TUB1. Data represent average expression levels over parental with SE represented in error bars from a minimum of three independent experiments in (A) a wildtype background and (B) a rad9-deficient background. REST (Relative expression software tool) was used to compare expression data from each mutant strain to its parental and generate relative expression profiles where ** P < 0.05.
In strains harboring rad9Δ/rad9Δ deletions, both heterozygous and homozygous deletion of sam2 resulted in significant decreases in SAM1 expression (Figure 4B). This is in line with observations in the wild-type background strains. However, where the average expression level of SAM2 in sam1 deletion strains in a wild-type background was >1.0 relative to the parental, this increase is lost in the rad9-deficient background. SAM2 expression appears unchanged due to the heterozygous loss of sam1 and decreased due to the homozygous loss of sam1.
AdoMet levels are differentially altered in SAM1 and SAM2 knockout strains
We next hypothesized that if altering SAM gene expression affects genome stability via a mechanism involving changes to AdoMet concentration, we should be able to detect changes in the amount of AdoMet between the strains that display instability and those that do not. In order to directly quantify AdoMet pools, cells were homogenized and subjected to ultraperformance liquid chromatography mass spectrometry analysis. Total pool concentrations of AdoMet are shown in Table 4. In a wild-type background we see increased AdoMet levels due to the sam1 deletion alone: sam1Δ/SAM1 and sam1Δ/sam1Δ strains. This correlates with our expression data, as reduced sam1 copy number results in increases in SAM2 expression, which could then be responsible for increases in overall AdoMet production. Statistically significant decreases in AdoMet concentrations are seen due to the complete loss of sam2, (sam2Δ/ sam2Δ and sam1Δ/SAM1 sam2Δ/sam2Δ strains). This again correlates with expression data; in the absence of sam2Δ/sam2Δ, SAM2 is not expressed and SAM1 expression is repressed. This leads to the lowest overall amount of total SAM gene expression, which then leads to substantially reduced AdoMet levels.
In the rad9-deficient background we again see decreases in AdoMet levels due to the loss of SAM2. This decreased concentration, however, returns AdoMet levels to that seen in wild-type cells, as the rad9-deficiency elevates AdoMet concentrations on its own relative to wild type (Table 4). Three strains in this category show these decreases, sam2Δ/sam2Δ rad9Δ/rad9Δ, sam1Δ/SAM1 sam2Δ/SAM2 rad9Δ/rad9Δ, and sam1Δ/SAM1 sam2Δ/sam2Δ rad9Δ/rad9Δ. This aligns with our results showing deletion of sam2 results in significant decreases in SAM1 expression (Figure 4B).
SAM gene mutations affect overall cell size without displaying consistent differences that would point to cell cycle delay phenotypes
Alterations in S. cerevisiae cell morphology have previously been associated with deficiencies in the cell cycle. Bud size has been shown to correlate with cell cycle phase and overabundance of cells with a particular bud-to-mother size ratio can therefore indicate a cell cycle halt or delay (Pringle and Hartwell 1981; Weinert and Hartwell 1988). Multibudded phenotypes are associated with failed progression through G1 in cell cycle mutants, and have been seen due to deletions in cyclins as well as checkpoint control genes (Snyder et al. 1991; Schwob et al. 1994). Further, observations on colony and cell size/area have been measured to assess relative health of a colony and cells, with smaller colonies often denoting smaller individual cells or slower progression through the cell cycle and thus growth rate of cells within the colony. Therefore we assessed our strains to determine if SAM gene mutations result in altered morphologies that could indicate cell cycle progression defects (Table 5). One hundred cells for each strain were measured for the length and width of both the mother and the bud (if present), and the area of each was then calculated as (π × radius of length × radius of width). Calculations of the average areas of the mother cell for each strain, with 95% CIs, indicate that full deletion of sam1 as well as sam2 mutations on their own result in cells of decreased size (sam1Δ/sam1Δ, sam1Δ/sam1Δ sam2Δ/SAM2, sam2Δ/SAM2, and sam2Δ/sam2Δ strains). Interestingly strains heterozygous for sam1 and homozygously deletant for sam2, sam1Δ/SAM1 sam2Δ/sam2Δ, are larger than wild-type cells. Further, homozygous sam1 mutation alone results in cell that are elongated; thus, these cells are both small and less round than wild-type cells. We investigated all strains for bud size distribution to determine if this phenotype might correlate with having more cells that failed to enter the cell cycle or froze at particular points. However, no changes were observed in the distribution of cells with no buds, small buds, medium buds, or large buds in any of our mutant strains. Investigation of these mutations in a rad9-deficient background showed that all mutant strains containing any SAM gene mutation were smaller than the rad9Δ/rad9Δ parental; mutation to sam1Δ/SAM1 sam2Δ/sam2Δ no longer leads to an enlarged phenotype in the rad9Δ/rad9Δ background. No additional abnormalities, in bud size distribution or elongation, were noted.
Strains mutated for SAM1 and SAM2, in different combinations, demonstrate alternate responses to HU-induced stress
Many deletions linked to increases in cancer incidence exert their functions by increasing the instability rates of cells, weakening defenses against exogenous stress, or both. Therefore, we sought to characterize our strains for alterations in response to exogenous stressors. To this end, we tested our strains for sensitivity or resistance to a range of insults, including HU, UV, phleomycin, and benomyl (Table 6). In strains in the wild-type background no significant change in the response to agents that cause direct DNA damage was seen due to any combination of SAM1 or SAM2 deletions; response to UV exposure–induced thymine-dimers and phleomycin-induced adducts via direct intercalation were unchanged. Exposure to benomyl-induced microtubule blockage resulted in a slight increase in sensitivity in both of the strains mutant for three of the four copies of the SAM genes: sam1Δ/sam1Δ sam2Δ/SAM2 and sam1Δ/SAM1 sam2Δ/sam2Δ. The most interesting results, however, were the growth patterns in response to HU, where heterozygous loss of SAM2 in the sam1Δ/SAM1 sam2Δ/SAM2 and sam2Δ/SAM2 strains showed a resistance to this inhibitor of ribonucleotide reductase (RNR). However, homozygous loss of SAM1, in the sam1Δ/sam1Δ and sam1Δ/sam1Δ sam2Δ/SAM2 strains, showed increased sensitivity to the same treatment.
In strains already lacking a Rad9-dependent DNA damage checkpoint, we again saw no increased response (over parental) due to direct DNA damage from UV or phleomycin exposure (Table 6). We also saw no changes in growth due to the benomyl inhibition of microtubule dynamics. However, HU treatment once again resulted in an altered response. Here, we again observed sensitivity in the two strains homozygously deleted for SAM1: sam1Δ/sam1Δ rad9Δ/rad9Δ and sam1Δ/sam1Δ sam2Δ/SAM2 rad9Δ/rad9Δ.
Discussion
AdoMet is the main methyl donor in the cell and also feeds into other pathways and product syntheses via the methyl cycle. As many of these pathways have potential effects on genome stability, it is unsurprising that AdoMet synthetase disruption and altered AdoMet levels have been linked to a variety of cancer types. Interestingly, both increases and decreases in gene expression, as well as in AdoMet concentration itself, have been found across these various cancer types.
Previously we reported a strain deleted for one of the AdoMet synthetase genes demonstrated a haploinsufficient effect on genome instability, but the underlying mechanism of action remained unclear (Strome et al. 2008). We present data here that the SAM1 and SAM2 genes have different effects on genome stability. By studying these AdoMet synthetase genes in yeast and creating the full complement of viable mutant strain combinations, we have been able to contribute to the field by generating sets of strains that demonstrate different phenotypes for further study. Additionally, by including studies of morphology and effects on growth due to exogenous stressors, we are able to further categorize our mutants and propose possible mechanisms by which these gene mutations cause their effects on genome instability. While we began this study in an attempt to identify one mechanism of action for SAM mutational effects on genome stability, we clearly have two distinct mechanisms dependent on having functional copies of SAM1 vs. SAM2.
Loss of SAM2
Strains homozygously deleted for SAM2, sam2Δ/sam2Δ and sam1Δ/SAM1 sam2Δ/sam2Δ, share the characteristics of having increased genome instability (Figure 2A and Table 1), decreased AdoMet levels (Table 4), and no altered reaction to HU (Table 6), in a wild-type background. These strains have significant increases in CTF rates, indicating that the increases in genome instability reflect, at least in part, increases in chromosome loss events. SAM2 mutations also increase conversion to CAN resistance at an elevated rate and these events occur primarily through mitotic recombination mechanisms. These strains have the lowest total cumulative expression from the SAM1 and SAM2 loci (Figure 4A), as well as the lowest AdoMet levels (Table 4). Work by others has found that SAM2 loss results in a significant increase in methionine levels at 4.5 mM compared to 0.13 mM in wild-type cells (P-value = 7.39 × 10−85) (Mülleder et al. 2016), and that excess methionine represses SAM1 expression (Thomas et al. 1988). Inclusion of AdoMet in the media fully suppresses genome instability increases seen due to loss of SAM2. The suppression back to wild-type levels of instability without being further stabilizing, as well as the observation that adding AdoMet to wild-type cells does not confer a stabilizing effect, leads to the conclusion that in the presence of exogenous AdoMet, cells maintain normal AdoMet levels without acquiring excess concentrations. Thus, genome instability in these strains likely results from low AdoMet levels, a necessary compound for survival, as demonstrated by the lethality of a double sam1Δ sam2Δ full deletant. As the second most highly utilized enzyme substrate in any cell, low levels of AdoMet could bring about genome instability through a variety of different mechanisms (for model see Figure 5), the resolution of which will require further study. For example, AdoMet has also been implicated in G1 progression delay, which could be disrupted in strains with low levels of this compound, allowing cells to cycle when they are ill equipped to do so without mistakes (Mizunuma et al. 2004). AdoMet is also thought to suppress the production of other methylation compounds (Bawa and Xiao 1999). In these cells, reduced AdoMet levels could lead to the cellular production of more mutagenic methyl donors that interact more frequently, resulting in increased alkylation and increased instability. Also, reductions in AdoMet likely impede production of other components of the methyl cycle. In one branch, the transsulphuration pathway feeds out of the methyl cycle where AdoMet conversion to S-adenosylhomocysteine leads to production of homocysteine and then GSH. GSH, used with GSTs, are a major oxidative species sink used by cells to prevent DNA and protein reactions with reactive oxygen species, thereby protecting the genome from damage. At another point, homocysteine feeds into tetrahydrofolate pools, which are a necessary deoxyribonucleotide triphosphate (dNTP) production cofactor. Reduced dNTP levels have been shown to decrease DNA synthesis, thus decreasing a cell’s ability to repair DNA and perform recombination (Paulovich et al. 1997; Zhao et al. 1998; Chabes et al. 2003). A final mechanism might relate to recent work that has identified a novel protein complex named SESAME (SErine-responsive SAM-containing Metabolic Enzyme complex), which contains Pyk1, serine metabolic enzymes, Sam1, Sam2, and acetyl-CoA synthetase. Both H3K4 methylation by the Set1 methyltransferase complex as well as H3T11 phosphorylation require this complex. Deletions of either sam1Δ or sam2Δ resulted in a global reduction of both H3K4me3 and H3pT11 (Li et al. 2015), indicating a direct role for AdoMet synthetase genes in histone methylation and phosphorylation events. These alterations in histone regulation may cause global or local gene expression changes that result in increased genome instability through a variety of pathways.
Models of SAM1 vs. SAM2 perturbations to the methyl cycle resulting in genome stability effects. Top left panel: Known methyl cycle pathway in S. cerevisiae. Bullet points in blue at the top are known points about cells in steady state and the portions of the methyl cycle that might affect genome stability. Top right panel: Effects observed in sam2-deficient cells due to the sole functionality of SAM1. Points in blue are supported from previous data or data presented here. Red X represents the model supported here in which presence of SAM1 alone does not sufficiently generate AdoMet from methionine and ATP, leaving a decreased AdoMet pool and an increased methionine concentration, impeding the methyl cycle leading to increased genome instability. Bottom panel: Effects observed in sam1-deficient cells due to the sole functionality of SAM2. Points in blue are supported from previous data or data presented here. Two models are proposed that might explain the decreased genome instability observed. Model A (left): Red Xs represent points where lack of SAM1 impedes cellular sensing of AdoMet for AdoMet usage in downstream pathways. Decreased genome instability likely occurs due to increased AdoMet levels suppressing production of more reactive methyl donor species. Model B (right): Red arrows represent points were cycle is overactive due to lack of SAM1 to sense and control AdoMet levels. Increased AdoMet increases methyl cycle cyclization and decreased genome instability may arise from increased AdoMet suppression of alternate more reactive methyl donors, increased GSH for ROS scavenging, and/or increased dNTP that can facilitate genome repair.
Work in our rad9-deficient strains adds additional information to the model. In these strains the instability due to loss of SAM2 is not seen (Figure 3A). We propose this likely comes about in one of two ways. First, AdoMet levels are decreased in these strains but are measured at levels we observed in wild-type cells (Table 4). Perhaps this reduction is not low enough to perturb the system and AdoMet levels are sufficient to suppress production of more mutagenic methyl donors and fully serve in all methylation reactions including those mediated by SESAME. However, the addition of exogenous AdoMet marginally lowers the instability rate in these strains (Figure 3B). This could indicate the strains are not quite maintaining an adequate level of AdoMet for full functionality. A second mechanism could involve Rad9’s known positioning upstream of the RNR2 and RNR3 genes, which are involved in the ribonucleotide reductase production of dNTPs (Navas et al. 1996). If the induction of instability due to loss of SAM2 comes through lowered dNTP production, this pathway is already suppressed due to loss of RAD9 and thus no further increase in genome instability is observed. A combination of these mechanisms also cannot be ruled out.
Loss of SAM1
Conversely, harboring sam1 mutations alone, either heterozygous or homozygous, results in statistically significant decreases in genome instability (Figure 2A), and increases in AdoMet levels (Table 4). SAM2 expression is not reduced in these sam1 mutant strains, and appears to trend toward increased expression (Figure 4). Work by others has found the same increase in methionine levels due to SAM1 loss, at 4.6 mM compared to 0.13 mM in wild-type cells (P-value = 5.48 × 10−85) (Mülleder et al. 2016), and that excess methionine induces SAM2 expression (Thomas et al. 1988). In these strains, the observed genome protection is likely linked to increased AdoMet (for models, see Figure 5). The addition of AdoMet to the media returns the instability rate to a wild-type level in sam1Δ/SAM1 strains but not in the sam1Δ/sam1Δ strains (Figure 2B). This could indicate that in heterozygous SAM1 mutant strains the alterations leading to accumulation of AdoMet are suppressed, as the cell does not rely on the mutated SAM1/methyl cycle pathway, instead importing and using exogenous AdoMet and maintaining normal AdoMet levels. The lack of action of this mechanism in the full SAM1 deletant cells points to a role for SAM1 in the sensing or use of exogenous AdoMet to accomplish the suppression. Further the increased levels of AdoMet seen in SAM1 mutant cells points to a role of SAM1 in appropriate sensing of AdoMet levels or usage of AdoMet once produced. Two models therefore emerge from these observations: that AdoMet accumulation is tied to impediment of the methyl cycle if the AdoMet cannot be appropriately used in the absence of SAM1, or alternatively, that AdoMet accumulation is tied to overactive movement through the methyl cycle if the AdoMet cannot be appropriately sensed to regulate cycling (Figure 5). In the first model of cycle impediment, genome stability is likely due to the protective effect of AdoMet that has previously been reported in yeast (Bawa and Xiao 1999), specific to O-methyl lesions, and may be due to the suppression of production of other compounds with reactive methyl groups. In addition, several studies have described the protective effects of AdoMet in hepatocarcinoma. The mechanism of this protective effect remains unclear, potentially involving DNA methylation effects (Adams and Burdon 1987) or a reduction of DNA synthesis and cell loss in the cancerous tissues (Taguchi and Chanarin 1978; Pascale et al. 1995). In the second model where increased AdoMet results in increases across the methyl cycle, genome stability could come from multiple branches. As discussed above, the methyl cycle creates precursors for GSH production used in Reactive Oxygen Species (ROS) scavenging as well as for dNTP production critical for replication and repair. Increases in either or both of which could result in a more stable genome due to less ROS insults or increased repair capacity with increased dNTP levels. The observation that homozygous deletion of sam1 (sam1Δ/sam1Δ and sam1Δ/sam1Δ sam2Δ/SAM2) makes these cells more sensitive to HU, may support decreased conversion (Figure 5, model A) over increased cycling (Figure 5, model B). The cytotoxic and cytostatic effects of HU have primarily been linked to its reduction of dNTP pools and/or its effects in raising the levels of ROS. To be more sensitive to HU, we would therefore expect these cells to already have lower dNTP pools and/or higher ROS levels, both of which are affected by the portions of the methyl cycle downstream of AdoMet. If SAM1 mutation results in increased AdoMet due to a lack of proper utilization of this compound, then the necessary downstream components needed for reducing ROS (GSH) and producing dNTPs (tetrahydrofolate), would also be reduced.
In the rad9-deficient strains we still see the protective effects of harboring SAM1 mutations (Figure 3A), but we do not see the same level of elevation of AdoMet concentration as in wild-type cells (Table 4). While this does not point to one model over another it does facilitate our future ability to ask whether the observed AdoMet levels in these strains are sufficient to still suppress production of other more reactive methyl species.
Strains harboring mutations in both SAM1 and SAM2 may speak to methyl cycle importance in genome stability
The differing effects on instability, with SAM2 mutations increasing genome instability and SAM1 mutations conferring a protective effect, make interpreting the data in strains that harbor mutations in both genes difficult. However the intermediary phenotypes may be showing us more information about the importance of steady state regulation of the methyl cycle in genome stability, as well as the mechanisms in place to maintain this steady state. For example, strains with heterozygous deletions in SAM2, sam2Δ/SAM2 and sam1Δ/SAM1 sam2Δ/SAM2, are characterized by increases in genome instability (Figure 2A), normal AdoMet levels (Table 4), and resistance to HU (Table 6), in a wild-type background. While the total AdoMet pool level is not statistically altered due to these particular SAM gene mutations (Table 4), this is likely due to a vacillation between the effects of partial loss of the genes and not due to lack of alteration to the system. Therefore, we can see in these strains that AdoMet level alone is not sufficient to predict genome instability as these mutants, and several others, have normal AdoMet concentrations but altered stability rates. Likely cellular changes to the methyl cycle, occurring in response to the AdoMet vacillation or in an attempt to mitigate these fluctuations, contribute to instability increases. This demonstrates the balancing act the cell must accomplish in the regulation of the methyl cycle used to maintain these AdoMet levels. These methyl cycle alterations could then play roles in the observed instability. The altered growth patterns in the presence of HU could indicate some of these differences. As mentioned above the effects of HU are linked to its reduction of dNTP pools and its effects in raising the levels of ROS. To see resistance to HU based on these mechanisms, it could be hypothesized that these strain mutations result in alterations to the methyl cycle that lead to increased dNTP pools (thus strains are able to withstand the dNTP reductions resulting from HU treatment) or have increased resistance to the HU-induced rise in ROS (possibly through higher GST/GSH levels making ROS levels reduced before HU treatment in these cells). While we are not able to distinguish the mechanism within the scope of the results presented here, the more likely model would be that these strains are showing HU resistance due to increases in dNTP pools, which have been linked (unlike decreases in ROS) to increases in genome instability. Previous work demonstrated a mutator phenotype when dNTP levels exist at higher than normal amounts in both yeast (Chabes et al. 2003; Davidson et al. 2012; Fleck et al. 2013) and mammalian cells (Weinberg et al. 1981; Caras and Martin 1988) [for in depth review see Pai and Kearsey (2017)]. This effect has been attributed to increased dNTP availability speeding up the S-phase (Kunkel et al. 1987; Stodola and Burgers 2016), increasing DNA polymerase binding and extension from an inaccurate primer-template pairing, and reduced proofreading efficiency (Beckman and Loeb 1993; Kunkel and Bebenek 2000). This effect, seen in yeast and mammalian cells, could be even more dramatic in mammalian cells where high dNTPs levels have also been shown to inhibit apoptosome formation (Chandra et al. 2006). Thus, in cancer cells this pathway could be doubly important as it affects two phenotypic hallmarks of cancer, increased genome instability and decreased apoptosis.
Conclusions
Our group has conducted studies of SAM gene dosage and determined the effects of changes in AdoMet synthetase genes on genome stability. SAM1 and SAM2 clearly operate by two distinct mechanisms to impart different effects on genome stability. The findings reported here provide evidence that can aid in the interpretation of how different cancer types are associated with increases or decreases in expression from the MAT genes and adds to the field by demonstrating a link in yeast between SAM gene dosage and genome instability. S. cerevisiae are particularly well-suited to continue to work on more mechanistic insight into the roles of AdoMet and the methyl cycle in genome stability as these are a unique model organism not shown to use DNA methylation. Many current hypotheses on the effects of AdoMet in cancer involve alteration to DNA methylation changes, but yeast show there must be additional components contributing to the instability phenotypes.
Acknowledgments
The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. Research was supported by an Institutional Development Award (IDeA) from the National Institute of General Medical Sciences (NIGMS) of the National Institutes of Health (P20GM1234) and an NIGMS R15 Area Award (1R15GM109269-01A1). Statistical support for this publication was provided by Arnold J Stromberg and Jiaying Weng through the Applied Statistics Laboratory at the University of Kentucky via NIGMS grant number P20GM103436.
Footnotes
Supplemental material available at FigShare: https://doi.org/10.25386/genetics.8949467.
Communicating editor: J. Nickoloff
- Received June 14, 2019.
- Accepted July 15, 2019.
- Copyright © 2019 by the Genetics Society of America
