The P{wHy} collection:

This collection is derived from a hybrid transposon molecule described in Huet et al. (2002), which depicts the primary mechanism. Briefly, P{wHy} is a compound element comprised of P-transposon carrier arms and a central deleter transposon, hobo, which is flanked by white and yellow genes. Flanking deletions are obtained by introducing a source of hobo transposase, followed by recombination between the original and second copy of hobo; the direction of the deletion is indicated by the particular P{wHy} marker lost. The genetic schemes and strains for the basic manipulation of P{wHy} transposition are described in Huet et al. (2002).

The collection currently consists of >800 inserts and was generated by interchromosomal remobilization of an X-associated starting insertion, using the standard P-transposition methods. The resulting P{wHy} insertions in this collection thus reside predominantly on chromosomes II and III, with a more limited number of insertions on chromosome IV. The fly strains containing these autosomal insertions are available through the Drosophila Stock Center at Bloomington, Indiana.

Mapping of P{wHy} insertions:

The P{wHy} insertion mapping has been archived through FlyBase/Bloomington Stock Center (http://flystocks.bio.indiana.edu/Browse/insertions/PwHy-top.htm) (under the collections title “Deletion Generators”) and the Drosophila Gene Disruption Project (Bellen et al. 2004); the present study also reflects substantial mapping and annotation running through 2008 in the sequence database and FlyBase. Transposons were mapped by extraction of Drosophila adult DNA (Huang et al. 2000), followed by short genome walking with iPCR (Ochman et al. 1988; Triglia et al. 1988)—using P-related primers (Bellen et al. 2004)—and with the Universal Fast Walking method (Myrick and Gelbart 2002). Basic Local Alignment Search Tool (BLAST) alignments (Altschul et al. 1990) were performed against the GenBank database and the Berkeley Drosophila Genome Project (BDGP) database (Adams et al. 2000; Celniker et al. 2002). Only insertions whose locations could be rigorously assigned at the molecular level were considered for inclusion in the current P{wHy} collection.

Transrecombination:

y⁻w⁻; P{5′wHy}14F06W or 14H10W/SM6a; P{hsH\T-2}/+ males were crossed to y⁻w⁻;P{3′wHy}02B10Y/SM6a virgin females and progeny were heatshocked on days 2, 4, and 6 for 30 min at 37°. F₁ males were collected and crossed to yw;Gla/SM6a virgin females and progeny were screened for the presence of both the w⁺ and y⁺ markers.

Molecular and genetic tests of transrecombinant strains:

PCR tests of the 5′ 14F06 and 14H10 insertion sites and the 3′ 02B10 insertion site were performed as described in Mohr and Gelbart (2002) with Pendout2 and genomic DNA-specific primers. Long-range PCR detection of an intact P{wHy} element was performed with the primers ASR5 and SER5 at 68° and ASR6 and SER6 at 55° with LA-Taq (Takara Mirus Bio): ASR5, ctgccgataggtcagatgtcgtggc; SER5, agcttatggtgaagtgttgccaggc; ASR6, ccctttattaagatttcacacagatcagcc; SER6, ccacatgacgtatgagcaagtggca.

Test for positional silencing of P{wHy} insertions:

An eye mosaicism test was performed to determine if the repression of the white marker in a particular P{wHy} insertion was due to positional silencing, rather than to damage to the transposon itself . Briefly, virgin females of the line w*;+;P{Δ2-3}99B Sb/TM6—which constitutively expresses P transposase (Robertson et al. 1988)—were crossed to males of the candidate P{wHy} strain. The integrity of the transposon at the starting insertion site, and thus positional silencing at that site, would be indicated by the remobilization-dependent appearance of mottled pigmentation (mosaicism) in the eyes of the F₁ progeny.

Current status of P{wHy} distribution along the autosomes:

At present, the P{wHy} library is composed of 810 insertions (Figure 1) selected from a larger, starting collection of >2000 lines. The chief criteria for selection were (i) certainty of mapping on the chromosome, (ii) nonredundancy of insertion locus, (iii) even spacing of the inserts throughout the genome, and (iv) enhancement of the overall genome coverage provided by the established mutational collections, based on P{wHy} deletion and transrecombinational properties (see below). The average distance between each pair of inserts is 120 kb.

• Download figure
• Open in new tab
• Download powerpoint

Figure 1.—

Distribution of the current P{wHy} library on the autosomes. Each vertical tick along a chromosome arm represents an insertion site. The corresponding line graph follows the density of inserts by scanning the genome in 10,000 base increments, using a window of 200,000 bases.

Because the library was generated on the basis of the interchromosomal transposition of a P{wHy} element starting on the first chromosome, the inserts resulting from the expansion reside predominantly on the second and third chromosomes, with only a very few inserts on the fourth chromosome.

The distribution of P{wHy} inserts is as follows: 178 are on the left arm of chromosome II (2L); 194 inserts are on 2R; 212 inserts are on 3L; 251 inserts are on 3R; and just 3 inserts are on the fourth chromosome. At the time of this writing, 810 of these 838 lines have been archived at the Bloomington Stock Center. There are a relative few genome regions of sharply reduced P{wHy} density—i.e., where there is significantly greater than the average separation of 120 kb between inserts. An interval on 2L, at nucleotide coordinates corresponding to cytology 29E–30B10, is the largest region devoid of inserts. However, a query of FlyBase (http:www.flybase.org) reveals that there are at least 100 transposon insertions from the established insertion collections in this interval, including a number of elements from the extensive Rorth collection (Rorth et al. 1998). This observation would immediately indicate that the absence of P{wHy} in this region is simply a statistical fluctuation and not a generalized exclusion of P transposition.

Efficiency of generating P{wHy}-based deletion sets:

We sought to characterize the overall efficiency of P{wHy} in making deletions suitable for genomic annotations. The lines indicated in Table 1 were analyzed statistically for this purpose. The hobo-mediated deletions were first molecularly screened against P{wHy}-confined hobo mobilization by PCR test as earlier described (Huet et al. 2002). New hobo flanking sequence for “genomic events,” having deletion endpoints lying outside of P{wHy}, was successfully determined 67% of the time (Table 2), using iPCR or UFW mapping (see materials and methods); that a higher percentage was not achieved tended to reflect sequencing interference rather than failure to synthesize the mapping amplicon. We also observed that 87.4% of these endpoints were nonredundant. Thus, only a minority of the genomic events were intractable to the mapping techniques employed.

The resulting deletions were further examined by stepwise analysis. Mobilization events fell into six categories: (1) “candidate deletions,” composed of successfully mapped, and otherwise unproblematic flanking sequence; (2) “elsewhere on the genome,” in which the hobo element lies very far (>800 kb, or on a different chromosome) from the starting insertion site; (3) events confined to P{wHy}; (4) “multiple events,” in which hobo occurs in multiple copies; (5) “insertion into repeats,” for which hobo is found within repetitive elements, so as to confound mapping; and (6) “other,” representing complex rearrangements, such as reversal of hobo orientation.

We found that 72.5% of deletions were <60 kb in size (Table 3), which we previously determined (Huet et al. 2002, which showed experiments sizing the extent of every event in a deletion set, including the less saturated 0.1–0.4 Mb range) to be the range within which deletion saturation can be effectively achieved using P{wHy}. Table 4 presents efficiencies for each stage of the P{wHy} strategy. There are wide differences among the various steps: <1% of 02H09 mobilization crosses yielded w⁺y⁻ derivatives, whereas 50% of the mapped derivatives generated candidate deletions. We observed that the steps of lesser or greater efficiency were consistently so among different starting lines, indicating that the hobo mobilization and the recovery of genomic events are the two key rate-limiting steps of the P{wHy} process.

Large deletions by transrecombination:

The ability to use P{wHy} to generate deletions of a very large, specific size would contribute to the utility of the P{wHy} tool, since with respect to deletions much larger than 60 kb, the original procedure deviates noticeably from a strictly flat distribution (Huet et al. 2002). We reasoned that hobo-transposase mediated recombination between P{wHy}-derived P{5′wHy} and P{3′wHy} elements could accomplish our goal (Figure 2). The size of the associated deletion is determined by the distance between the starting P{wHy} insertions. P{5′wHy} and P{3′wHy} elements derived from insertions 101 kb and 27 kb apart were generated in a previous study (Mohr and Gelbart 2002). To test if transrecombination results in efficient generation of larger deletions, we placed P{5′wHy}14F06W and P{5′wHy}14H10W chromosomes in trans to P{3′wHy}02B10Y chromosomes in the presence of hobo transposase. Next, we screened for and recovered the w⁺y⁺ phenotypic class indicative of successful transrecombination (Table 5).

• Download figure
• Open in new tab
• Download powerpoint

Figure 2.—

Transrecombination between P{5′wHy} and P{3′wHy} elements. (A) Strategy for generation of transrecombinants with P{5′wHy}14F06W and P{3′wHy}02B10Y elements. (B) Model of transrecombination. Hatched bars indicate the presence of deletions on the P{5′wHy} and P{3′wHy} chromosomes. Note that the 5′ insertion site of the P{5′wHy} element and the 3′ insertion site of the P{3′wHy} element define the extents of the deletion in the resulting transrecombinant and that reconstitution of a functional whole element permits restarting the original P{wHy} deletion scheme anew.

Genetic and molecular tests were used to determine if the resulting w⁺y⁺ strains had intact P{wHy} elements and associated deletions as expected. PCR analyses confirmed the 5′ and 3′ P{wHy} insertion sites and the presence of an intact P{wHy} element in the transrecombinant strains. Genetic analysis confirmed that the deletions behave as expected in complementation tests with available genetic reagents in the region (Table 6; Mohr and Gelbart 2002). Together these data suggest that transrecombination provides an efficient method for generating deletions with an intact P{wHy} element (Table 6, Figure 2).

An indicator for positional silencing:

Although the white marker in P{wHy} is usually quite easily scored, a number of lines exhibited diminished expression of this gene. A subset of these flies had no detectable eye pigmentation (e.g., line DG37311 on 2L), and were scored y⁺w⁻. Such lines comprise ∼10% of the starting collection and include small groups that are locally clustered on the genome. (Fly stocks representing such regions were included in the companion submissions to the Bloomington Stock Center.) A smaller number of lines, ∼5% of the total, were scored y⁻w⁺. In our deletion experiments we also detected a small percentage of derivatives that were phenotypically y⁻w⁻, but were structurally y⁻w⁺ (Table 4). These observations are reminiscent of position effects on transposon markers previously reported by those investigating chromatin and long-range silencing (Balasov 2002; Yan et al. 2002).

We took advantage of the ability of the P{wHy} to remobilize upon introduction of a stable source of P transposase (Robertson et al. 1988). An eye mosaicism test was performed on a sample of the y⁺w⁻ flies to rule out the possibility that the P{wHy} element in such lines may have been damaged (e.g., during the expansion for making the P{wHy} library). We chose lines DG37311, DG37606, and DG37710 and reasoned that if the P{wHy} elements were still intact, (i) they should be capable of somatic remobilization and (ii) the expression of the white gene should reappear in some of the progeny, depending on where the remobilized element landed. This would result in a classic mosaicism, a patchy pigmentation based on multiple independent transposition events in a given eye.

We performed the cross diagrammed in Figure 3, in which the flies under examination were mated to the transposase-bearing flies in a w* (nonpigmented) genetic background. We obtained mottled eye color within the F₁ progeny, indicating that the P{wHy} element was structurally intact and that the gene silencing observed when the transposon was at its original location in line DG37311, DG37606, or DG37710 was due to positional silencing. It is noteworthy that the initial silencing was differential with respect to each transposon marker, allowing continued phenotypic detection from start to finish. These results suggest that P{wHy} is likely to be useful as a general tool for evaluating positional silencing (see discussion).

• Download figure
• Open in new tab
• Download powerpoint

Figure 3.—

Crosses for mosaicism test of positional silencing. Appearance of mottled eye color arising from somatic remobilization in F₁ progeny. Asymmetric marker silencing allowed phenotypic detection throughout these experiments.