RESULTS

Cloning of fmdS: A BLAST search performed on the University of Oklahoma A. nidulans EST database (http://www.genome.ou.edu/asper.html) revealed a sequence (EST c8h05a1.r1) with a high level of similarity to the formamidases of the bacteria M. methylotrophus and M. smegmatis (Mahenthiralingamet al. 1993; Wybornet al. 1996). Primers FMD1 and FMD2 based upon the EST sequence were used to amplify a 317-bp product from A. nidulans genomic DNA, which was then used to probe colony lifts of a chromosome III specific cosmid library (Brodyet al. 1991). Two hybridizing cosmids were identified, L19H02 and L20G07. Both cosmids were shown to complement the A. nidulans fmdS1 mutant (MH8375) in transformants directly selected on formamide as the sole nitrogen source. Neither of these cosmids lay within the region of the ordered minimal library indicated to contain the fmdS region of the chromosome (Pradeet al. 1997), nor were these cosmids adjacent to each other.

A 7-kb BamHI fragment capable of complementing the fmdS1 mutation was subcloned from cosmid L19H02. Sequencing 3.5 kb of the end of the clone to which the PCR fragment hybridized in Southern blots revealed that the fmdS gene contained four introns that were confirmed by cDNA sequence. Complementation of the fmdS1 mutation with the minimal 1.7-kb ScaI subclone (pJAF4155) confirmed the function of this sequence.

Two major startpoints of fmdS transcription within the fmdS promoter region were identified in multiple independent clones generated by 5′ RACE. The startpoints of transcription (at -21 and -12 relative to the predicted ATG) corresponded to the existence of two possible TATA boxes (both with the sequence TTA-TAC) lying at -59 and -48. An additional startpoint was detected within the first exon at nucleotide +7, which did not correspond to any recognized TATA sequence.

fmdS belongs to a highly conserved gene family: The predicted 45-kD 411-amino-acid FmdS does not share significant similarity with AmdS (Corricket al. 1987) but has 56% identity and 77% similarity to the formamidase of M. methylotrophus, with conservation across the entire protein. Similarity to the M. smegmatis enzyme is lower (66%), with no homology at the carboxyl terminus (Figure 1). Database searches using the predicted FmdS protein sequence identified previously uncharacterized highly conserved formamidase-like sequences in the genomes of prokaryotic, eukaryotic, and archaeal species (Figure 1). Full sequences have been isolated as part of the genome sequencing projects of Bordetella pertussis, B. bronchiseptica, Aeropyrum pernix, S. pombe, Candida albicans and two (in tandem) from A. thaliana. Tests on defined media showed that S. pombe could use formamide as a sole nitrogen source and that formamide enhanced growth of A. thaliana relative to growth in the absence of added nitrogen source, indicating that these formamidase sequences are likely to be functional. Incomplete sequences were also identified as ESTs from the plant species Oryza sativa (accession nos. C72046, D49000, D49028, and D46854), Zea mays (AI714639 and AI739746), Medicago truncatula (AW256497), Lotus japonicus (AW720090, AW720252, and AW719264), Sorghum bicolor (AW564921), and Lycopersicon esculentum (AI782257). All of these proteins are distinct from the two major amidase families (the nitrilase and amidase signature group) and more closely resemble ureases (Novoet al. 1995).

Regulation of fmdS by nitrogen metabolite repression: Previous studies of the regulation of formamidase activity showed a lack of induction by formamide yet strong regulation by nitrogen metabolite repression (Hynes 1970, 1972). In an attempt to localize the promoter elements responsible for this response, an fmdS::lacZ promoter deletion series was constructed and integrated in single copy at argB as described by Punt et al. (1990). Each strain was assayed under growth conditions of nitrogen and carbon starvation or sufficiency (Figure 2). The longest fmdS::lacZ fusion (pJAF4241, with 599 bp of fmdS promoter) displayed a 10-fold increase in expression during nitrogen starvation. Four potential AreA recognition sequences (HGATAR) were identified within the fmdS promoter, and the deletion series was used to determine the relative contribution of each site. The sites at -70 (TGATAG), -145 (CGATAA) and -160 (AGATAA) relative to the predicted fmdS start codon all contribute to fmdS::lacZ expression under nitrogen-limiting conditions, with the site at -145 only playing a minor role. The site at -315 (TGATAA) appeared to have little effect on the regulation of fmdS, with the deletion of this region actually corresponding to a slight increase in the basal levels of β-galactosidase activity, perhaps through the removal of other regulatory sequences (Figure 2).

• Download figure
• Open in new tab
• Download powerpoint

Figure 1.

—Alignment of 10 predicted formamidase-type enzymes. Identical residues are indicated by dark shading; similar residues are indicated by light shading. The alignment was generated using Pileup (GCG software package, Devereauxet al. 1984) and viewed with Boxshade (Bioinformatics group, ISREC). At1, A. thaliana formamidase 1 (accession no. CAB38294); At2, A. thaliana formamidase 2 (CAB38295); An, A. nidulans; Ap, A. pernix (BAA79495); Bb, B. bronchiseptica; Bp, B. pertussis; Ca, C. albicans; Mm, M. methylotrophus (Q50228); Ms, M. smegmatis (Q07238); Sp, S. pombe (CAB60014). Preliminary sequence data for C. albicans, B. pertussis, and B. bronchiseptica was obtained from The Institute for Genomic Research website at http://www.tigr.org.

The areA217 loss-of-function allele abolished the response to nitrogen starvation for all constructs showing that the response was AreA dependent. Expression of fmdS::lacZ was unaffected by the tamAΔ mutation (results not shown) in agreement with previous studies (Arst and Sheerins 1996).

Effects of carbon starvation on fmdS expression: The absence of a carbon source led to loss of response to nitrogen starvation of fmdS::lacZ expression (Figure 2). Earlier studies on formamidase levels showed a reduced response to nitrogen starvation in the absence of an added carbon source (Hynes 1972). This was observed with all fusion constructs, indicating that the effect was not due to a specific site in the fmdS promoter. Reduced fmdS::lacZ expression was observed only upon complete carbon starvation, with the poorer carbon sources, lactose, fructose, or limiting glucose (0.1% w/v), giving expression equivalent to 1% glucose (results not shown). In A. nidulans carbon catabolite repression (CCR) is mediated by the zinc-finger repressor protein CreA (Dowzer and Kelly 1991). Analysis of the fmdS promoter identified possible tandem CreA recognition sites at -409 and -399 (CCCCACCCAGCCCCGCGGA) (Cubero and Scazzocchio 1994; Panozzoet al. 1998). Equivalent sites with almost identical flanking sequence (CTCCAGCCCAACTCCGCGGA) are also seen in the niaD promoter (Johnstoneet al. 1990). Hynes (1973) showed that nitrate reductase levels are also low under carbon starvation conditions. Introduction of the creA204 loss-of-function allele led to a reduction of fmdS::lacZ expression although the response to AreA was still apparent (Table 2). Removal of the tandem CreA sites had no detectable effect on expression of the reporter construct (Figure 2).

• Download figure
• Open in new tab
• Download powerpoint

Figure 2.

—Deletion analysis of fmdS::lacZ regulation. Reporter gene constructs with varying fmdS promoter lengths were targeted in single copy at the argB locus (Puntet al. 1990). Constructs were designed to sequentially remove potential regulatory elements (represented by the indicated symbols) with the expression of each construct assayed in areA⁺ and areA217 genetic backgrounds under different growth conditions. Mycelium was grown in 100 ml of 1% glucose and 10 mm ammonium tartrate medium at 37° for 16 hr, washed with carbon-free/nitrogen-free media, and then transferred to the indicated growth media for 4 hr. When present after transfer, glucose was at 1% w/v. NH₄ indicates 10 mm ammonium tartrate; -N is nitrogen free. Values are given in units per minute per milligram of protein and represent the results of at least three separate experiments with standard errors shown.

A time course analysis of the effect of carbon starvation on fmdS::lacZ expression was performed (Figure 3). Following transfer of mycelia to carbon-sufficient (1% glucose), nitrogen-free media, a short phase of no detectable change in expression was followed by β-galactosidase levels increasing over a 3-hr period. Transfer of mycelia to carbon-free media at 2.5 hr led to a rapid loss of the response, comparable to that caused by the protein synthesis inhibitor cycloheximide. This effect was also observable irrespective of the time of transfer (data not shown). The nonmetabolizable glucose analogue 2-deoxyglucose (2-DOG) is sufficient at 0.5% w/v to cause CCR of amdS expression mediated by CreA (M. J. Hynes, unpublished results). Transfer of mycelia to carbon-free/nitrogen-free media containing 0.5% 2-DOG for 4 hr did not simulate carbon sufficiency and allow fmdS::lacZ expression (data not shown). The lack of effect of the creA204 mutation on the response to nitrogen starvation combined with the inability of 2-DOG to substitute for glucose implies that the loss of AreA control of fmdS expression is in response to a signal independent of carbon catabolite repression.

• Download figure
• Open in new tab
• Download powerpoint

Figure 3.

—Time-course analysis of fmdS::lacZ expression. A strain carrying fmdS::lacZ fusion plasmid pJAF4241 was assayed using conditions as described in Figure 2, with mycelia collected at half-hour intervals and assayed for β-galactosidase activity. Mycelia were transferred to 1% glucose/nitrogen-free growth media (⋄), carbon-free/nitrogen-free media (□), and carbon-free/nitrogen-free plus cycloheximide (▵). Mycelia were washed with carbon-free/nitrogen-free media prior to transfer. Values are given in units per minute per milligram of protein and represent the results of at least three separate experiments with standard errors shown.

• Download figure
• Open in new tab
• Download powerpoint

Figure 4.

—Identification of usgS, an upstream gene, within the promoter of fmdS. (A) Schematic representation and restriction map of the fmdS region. Exons are shown as shaded boxes (usgS dark, fmdS light). The presence of a divergent EST is indicated. Directions of transcription (arrows) are shown. B, BamHI; Bg, BglII; C, ClaI; H, HincII; S, ScaI; and X, XhoI. (B) usgS deletion constructs. Constructs allowed disruption of usgS through deletion of the first two exons (pJAF4472) and first three exons (pJAF4473) of usgS while still maintaining an uninterrupted fmdS promoter region. (C) Nucleotide and conceptual protein sequence of the area surrounding the usgS/fmdS intergenic region, showing UsgS residues 238-362 and FmdS residues 1-65. Putative fmdS TATA boxes are underlined and AreA recognition sites boxed. A CCAAT site shown to be required for the formation of a nucleosome-free region (Narendjaet al. 1999) is doubly underlined. usgS transcript polyadenylation sites are indicated with down arrows and fmdS transcriptional startpoints as determined by RACE with solid circles. Nucleotides are numbered with reference to the +1 at the start of the fmdS coding region. Lowercase letters indicate intron sequences.

Regulation of fmdS by AnCF: The 5′ region of fmdS has a CCAAT sequence (-112) that was shown to bind the A. nidulans CCAAT-binding factor (AnCF; Papagiannopouloset al. 1996; Steidlet al. 1999) by electromobility shift assay (data not shown). The same site has been shown to be required in an AnCF-dependent manner for the formation of a nucleosome-free region in the fmdS promoter (Narendjaet al. 1999). A strain deleted for the hapC gene encoding one of the subunits of AnCF (Papagiannopouloset al. 1996) displayed reduced growth on formamide as the sole nitrogen source. A hapCΔ background resulted in slightly reduced expression of the fmdS::lacZ fusion (Table 2). However, deletion of the CCAAT sequence had no noticeable effect on fmdS::lacZ expression (compare pJAF4242 with pJAF4499 in Figure 2). This could have been due to the deletion fortuitously bringing other regulatory sequences into the proximity of the fmdS promoter or more probably this is due to loss of usgS in this construct (see discussion).

The 5′ end of fmdS contains an overlapping gene: Previous studies of formamidase activity indicated a reduction of fmdS expression in areA102 strains, corresponding with a reduction in growth on formamide as a sole nitrogen source (Hynes 1972). However, expression of the fmdS::lacZ construct was equivalent to wild type in an areA102 mutant background (Table 2). To investigate this discrepancy further analysis of the fmdS promoter was undertaken. Sequence analysis and searches of the A. nidulans EST database revealed the existence of a gene within the promoter of fmdS transcribed in the same direction as the fmdS transcript. To sequence the entire gene an additional 1.3 kb of fmdS upstream sequence was obtained through cloning of a 3.3-kb ClaI fragment (pJAF4510) from cosmid L19H02. Isolation of three independent cDNA clones confirmed that the upstream gene (usgS) contained four introns and encoded a predicted 362-amino acid highly hydrophobic 41-kD product (Figure 4A). The usgS/fmdS intergenic region (from the stop codon of usgS to the start codon of fmdS) is only 242 bp and the usgS transcript overlaps that of fmdS by up to 150 bp, terminating within either the first exon or first intron of fmdS (Figure 4C). Database searches with usgS revealed a single homologue of unidentified function as an EST from the fungus Botrytus cinerea (accession nos. CNS01D74 and CNS019CV). Application of a hidden Markov topology prediction algorithm (Tusnady and Simon 1998) indicated that usgS is likely to encode a six-transmembrane helix protein with a long extracellular C-terminal tail.

Characterization of a usgS deletion strain: Two disruption constructs of usgS were created by replacing either the first two (pJAF4472) or first three exons (pJAF4473) of usgS in plasmid pJAF4510 with a riboB⁺ fragment from plasmid pPL1 (Oakleyet al. 1987b; Figure 4B). The riboB⁺-containing fragment was inserted in reverse orientation to ensure that no novel usgS transcripts were generated. For each construct a linear ClaI fragment containing the usgS::riboB insert was used to transform an areA102; pyroA4; riboB2 strain (MH50), selecting for riboflavin prototrophy. No obvious morphological phenotype could be seen in any RiboB+ transformants. Southern blot analysis of 30 transformants for each construct revealed one disruptant for each containing the desired integration event at usgS (data not shown).

Plate tests were used to determine if loss of usgS function gave rise to an altered growth phenotype on different carbon or nitrogen sources. Apart from formamide utilization, no other phenotypes were detected. Growth on either 10 mm or 50 mm formamide was noticeably stronger, particularly when comparing the usgSΔ areA102 double mutant (MH4473) to the parental areA102 strain (MH50), which showed poor growth and reduced mycelial density on formamide as the sole nitrogen source (Figure 5). Phenotypes of disruptants generated with either of the deletion constructs were identical, indicating that the new phenotype was not due to the particular positioning of the riboB⁺ fragment. The usgSΔ mutation was introduced by genetic crosses into an areA⁺ background. usgSΔ areA⁺ (MH9510) colonies grew slightly better than wild type (MH1). Therefore loss of usgS results in increased formamide utilization in both areA102 and areA⁺ backgrounds.

• Download figure
• Open in new tab
• Download powerpoint

Figure 5.

—Effects of deletion of the usgS gene on formamide utilization. Colonies were grown for 2 days at 37° on 1% glucose minimal medium. Nitrogen sources and concentrations are indicated. WT is wild-type strain MH97. The usgSΔ strain is MH9510, generated with the usgS knockout plasmid pJAF4473. areA102 usgSΔ [usgS] designates strain MH9467 (areA102 usgSΔ) transformed with multiple ectopic copies of usgS subclone pJAF4510 to give strain MH9487.

The plasmid pJAF4510 bearing usgS was cotransformed with the pyroA⁺ plasmid pI4 (Mayet al. 1989) into the areA102 usgSΔ strain. All cotransformants were phenotypically identical to the usgSΔ strains. Southern blot analysis indicated that the usgS⁺ plasmid had integrated ectopically into the genome and the genomic usgS was still disrupted, showing that the effects of the usgSΔ could not be restored in trans (MH9487, Figure 5). To confirm the lack of a trans-acting regulatory role for the usgS product on fmdS expression, the usgSΔ allele was introduced into an fmdS::lacZ background and no change in fmdS::lacZ expression was observed (results not shown). These results are compatible with usgS having a cis-acting effect on fmdS expression.

Analysis of transcription of fmdS and usgS by semiquantitaive RT-PCR showed that the fmdS product increased with nitrogen starvation and that levels were lower with carbon starvation (in agreement with the data presented in Figure 2). The usgS transcript was present in high levels on ammonium and showed only a slight response to nitrogen starvation and no change in response to carbon starvation (Figure 6). The loss-of-function areA217 allele resulted in levels of fmdS product not responding to nitrogen starvation. In agreement with usgS having a cis-acting effect, the fmdS product level was increased under both nitrogen limitation and sufficiency in the usgSΔ mutant. This response was most noticeable in repressing (glucose and ammonium grown) conditions.

• Download figure
• Open in new tab
• Download powerpoint

Figure 6.

—Semiquantitative RT-PCR analysis of fmdS and usgS transcription. All reactions were stopped while in their linear phase as described in Ha et al. (1999). Twenty-two PCR cycles were used for the benA control (using the primers BTUB2 and BTUB3), 26 cycles for usgS (USGrt1 and USGrt2), and 28 cycles for fmdS (fmdSrt1 and FMD2) except for the areA217 mutant where 30 cycles were used to enhance the signal. Wild-type RNA was isolated from strain MH1, areA217 RNA from strain MH341, and usgSΔ RNA from MH9510. Transcription of the constitutively expressed β-tubulin gene benA (Mayet al. 1987) was used as a loading control. Growth conditions were as described in Figure 2.

As none of the fmdS fusion constructs studied thus far had included the upstream gene, additional constructs were generated: a usgS::lacZ fusion (pJAF4622) and a usgS-fmdS::lacZ fusion (pJAF4504) that contained 3.1 kb of fmdS promoter, incorporating the upstream gene and its promoter (Figure 7). The expression of usgS::lacZ (pJAF4622) was not strongly regulated in agreement with the RT-PCR data (Figure 7). β-Galactosidase levels increased less than twofold under nitrogen starvation conditions, and this increase was eliminated by the areA217 mutation, indicating that usgS expression is weakly regulated by AreA. No major effects of carbon starvation were evident.

• Download figure
• Open in new tab
• Download powerpoint

Figure 7.

—Effects of the presence of usgS on fmdS::lacZ expression. β-Galactosidase assays of the three lacZ constructs under different growth conditions in the presence of different areA alleles were performed as described in Figure 2. Construct nucleotide coordinates are given relative to the ATG of fmdS. Wild-type data are reproduced from Figure 2 and Table 2. The lacZ fusions were crossed into the relevant mutant genetic background. Values are given in units per minute per milligram of protein and represent the results of at least three separate experiments with standard errors shown.

Inclusion of the upstream gene in the usgS-fmdS::lacZ construct (pJAF4504) led to a reduction in β-galactosidase levels under all growth conditions assayed compared to those observed for the construct lacking the entire usgS gene (pJAF4241, Figure 7). Under nitrogen-sufficient conditions expression of fmdS::lacZ was easily observed in the absence of usgS, whereas inclusion of the entire usgS gene reduced fmdS::lacZ expression to almost undetectable levels. The levels of usgS-fmdS::lacZ considered in conjunction with the phenotype of the usgSΔ strain on formamide suggested that transcription of the upstream gene was interfering with expression of fmdS. Despite little change in usgS::lacZ expression, expression of usgS-fmdS::lacZ was highly dependent on an AreA-mediated response to nitrogen starvation (Figure 7). Inclusion of usgS therefore changed fmdS from having leaky expression to being tightly regulated by nitrogen metabolite repression.

Alteration of usgS regulation affects fmdS expression: The areA102 mutation was previously found to result in ∼50% of wild-type formamidase activity (Hynes 1972, 1975b). This was not found for the assays of fmdS::lacZ fusions lacking usgS (Table 2). The areA102 mutant background resulted in increased usgS::lacZ expression under conditions of nitrogen limitation (Figure 7), consistent with the usgS promoter containing three potential TGATAR AreA recognition sites (at -305, -676, and -821 relative to the usgS predicted start codon). When usgS was present in the fmdS promoter (as in pJAF4504) the presence of the areA102 allele resulted in an ∼50% reduction in fmdS expression (Figure 7), consistent with the effects of areA102 on formamide utilization being due to increased usgS transcription that interferes with fmdS expression.

Constructs were generated to determine the effects of overexpression of usgS by inserting a hybrid promoter fragment from the alcA gene (Fillingeret al. 1995) fused to the pyrG promoter and coding region (Oakleyet al. 1987a; Figure 8A). Transformation of the usgSΔ/riboB⁺ pyrG^- strain MH9755 with pJAF4870 yielded a large number of pyrG⁺ transformants, all of which had a wild-type phenotype on 0.1% glucose with the inducer 1% ethanol present. No phenotype produced by usgS overexpression was observed, indicating that expression of ectopic copies of usgS via the alcA promoter did not affect fmdS expression. The gene replacement plasmid pJAF4871 was then linearized via ClaI digestion and transformed into the same strain. Scoring 200 transformants for growth on 1% ethanol/10 mm formamide media and on media lacking riboflavin revealed three classes of pyrG⁺ transformants: wild type, those that were still riboB⁺ and displayed reduced formamide utilization on ethanol, and a third class that was riboB^- with reduced formamide utilization. Southern analysis revealed that the second class had been generated by integration of circular pJAF4871 by a crossover event within usgS, introducing the pyrG/alcA::usgS fusion while retaining the deletion allele upstream in tandem. The third class was shown to be produced by a gene replacement event, with linearized pJAF4871 replacing usgSΔ/riboB⁺ with the pyrG/alcA::usgS fusion (Figure 8B). Both classes containing the alcA promoter fused to usgS in cis to fmdS were greatly impaired in formamide utilization (Figure 8C), indicating that increased usgS expression decreases fmdS expression.

• Download figure
• Open in new tab
• Download powerpoint

Figure 8.

—Effects of overexpression of usgS on formamide utilization. (A) usgS overexpression constructs. pJAF4870 was designed for ectopic overexpression of usgS and pJAF4871 to integrate at the usgS genomic locus. Exons are shown as shaded boxes (usgS dark, fmdS light). The pyrG/alcA hybrid promoter was fused to usgS at the BglII site in the usgS 5′UTR, creating a hybrid BamHI/BglII site. B, BamHI; Bg, BglII; B/Bg, BamHI/BglII hybrid site; C, ClaI; H, HincII. (B) The alcA::usgS gene replacement event. Linearized pJAF4871 were transformed into the usgSΔ/pyrG^- strain MH9755 with transformants selected for pyrG complementation (uridine and uracil prototrophy). The pyrG⁺transformants were screened for loss of the riboB⁺ selectable marker, causing riboflavin auxotrophy, and the integration event confirmed by Southern analysis. (C) Growth characteristics of alcA::usgS strains. Colonies were grown for 2 days at 37° on 1% glucose minimal medium, with 10 mm formamide as the nitrogen source. The ectopic alcA::usgS strain is a pJAF4870 transformant. usgSΔ::alcA::usgS was generated by integration of pJAF4871 via a single crossover event, giving the usgSΔ and alcA::usgS alleles in tandem. Generation of the alcA::usgS gene replacement strain is described in B.