Table 1 sgRNA production primers used in this study
Target geneSequence (5′ to 3′)CRISPRscan score
Universal reverseAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACN/A
slc45a2CTAGCTAATACGACTCACTATAGGTTACATAGGCTGCCTCCAGTTTTAGAGCTAGAAATAGCAAGUnscored
lhx1 exon 1CTAGCTAATACGACTCACTATAGGAGAAATGCTTCTCCAGGGGTTTTAGAGCTAGAAATAGCAAG64
lhx1 exon 2CTAGCTAATACGACTCACTATAGGTGTGCGGGCTGTGCCCAGGTTTTAGAGCTAGAAATAGCAAG87
lhx1 exon 3CTAGCTAATACGACTCACTATAGGCTCCCTTATGTGTCGGGTGTTTTAGAGCTAGAAATAGCAAG58