Table 2 qPCR primers used in this study
Primer namePrimer sequence (5′ → 3′)
NUP85-coding forwardTTCGCGAAGGAGCATAATGC
NUP85-coding reverseACACTTCCAATTCATTCAGAATCG
−733 FLO11 promoter forwardCAACAATACGGGCACAACTCA
−733 FLO11 promoter reverseTCACACCACCGATAGGCAATAG
−1325 FLO11 promoter forwardGAACGCCGGTAGGCAAATT
−1325 FLO11 promoter reverseTGGGCGACATTCTTGTCAAG
FLO11-coding forwardGTTCAACCAGTCCAAGCGAAA
FLO11-coding reverseGTAGTTACAGGTGGGTAGGTGAAGTG
IME1-coding forwardTCCCCTAGAAGTTGGCATTTTG
IME1-coding reverseCCAAGTTCTGCAGCTGAGATGA
−250 SUC2 promoter forwardGGTACGCCCGATGTTTGC
−250 SUC2 promoter reverseAGTCGTTTAAGCATTCCTCGAAA
18S rDNA forwardAATAAGGGTTCGATTCCGGAG
18S rDNA reverseTGGATGTGGTAGCCGTTTCTC