TABLE 1

Markers used in linkage map construction

Locus nameIdentification/BAC location in A. thalianaType of polymorphismAnnealing temperature (°)Forward primerReverse primer
Linkage group 1
AthACSF22L4MicrosatClauss et al. (2002)Clauss et al. (2002)
AAC/CG-88AFLP
AXR1At1g05180IndelKuittinen et al. (2004)Kuittinen et al. (2004)
ACA/CG-105AFLP
PhyAAt1g09570IndelKuittinen et al. (2004)Kuittinen et al. (2004)
ICE10F12F1MicrosatClauss et al. (2002)Clauss et al. (2002)
ICE13At1g13220MicrosatClauss et al. (2002)Clauss et al. (2002)
GIAt1g22770IndelKuittinen et al. (2004)Kuittinen et al. (2004)
AGG/CT-198AFLP
ATTS0392At1g30630MicrosatClauss et al. (2002)Clauss et al. (2002)
ACA/CG-228AFLP
VIP1At1g43700IndelKuittinen et al. (2004)Kuittinen et al. (2004)
At1g46768At1g46768Indel50AGGTTGATCATTTTCTAAAAGTTCTTGTTCCTCCTCCGTATCCCTCT
MTP1-CRFLP/SSCPDräger et al. (2004)Dräger et al. (2004)
Linkage group 2
F19K23At1g62050MicrosatClauss et al. (2002)Clauss et al. (2002)
ACA/CG-87AFLP
ACA/CG-160AFLP
ACA/CG-320AFLP
AAC/CG-84AFLP
SLL2At1g66680IndelKuittinen et al. (2004)Kuittinen et al. (2004)
lyr132aT23K23Microsat50GCCGTGAGATTAAAGAAGACGGCAAGAGCTGATCTCCATCC
ACA/CG-71AFLP
nga111F28P22MicrosatBell and Ecker (1994)Bell and Ecker (1994)
At1g75830bAt1g7583055CATATCTATGCAAATTGTGTTTAATATAACATGGGAAGTAACAGATACACTTATGA
ADH1At1g77120IndelKuittinen et al. (2004)Kuittinen et al. (2004)
Linkage group 3
At3g08040cAt3g08040Indel60TACCAACCAGCCACAGCAACCCGCTTTGTTTCCACTATTTGACTTTG
MDC16MDC16MicrosatClauss et al. (2002)Clauss et al. (2002)
nga162MDC16MicrosatBell and Ecker (1994)Bell and Ecker (1994)
DMC1At3g22880IndelKuittinen et al. (2004)Kuittinen et al. (2004)
At2-TCA1T9F8Microsat50CAACCACACCCCTTTAGCTTGAGAGCCCATGGAGATGAAG
HMA4At2g19110Indel62TGACCTGAAAATGAAAGGTGGTCTGCATAACTCCTGCAACAGCT
ICE14F11A3MicrosatBell and Ecker (1994)Bell and Ecker (1994)
ACA/CG-310AFLP
Linkage group 4
conAt2g21320MseIKuittinen et al. (2004)Kuittinen et al. (2004)
At2g22430dAt2g22430Indel55AGTTCAGATTCAGTGGGTGGGTAGATCTGTGAAACTCCGG
Ck2-alpha2At2g23080IndelKuittinen et al. (2004)Kuittinen et al. (2004)
NRAMP3eAt2g23150PsiI55TTGGATGTTTGGTCAAGCTAAGCCAAGTGTGCCACGAGCAATGAGGTAGAGGATGAAT
At2-TA5T19L18Microsat50TCATCGGATCCATATTTGTTTGCATTGTTGGTCGTGGCTATG
ELF3At2g25930MicrosatKuittinen et al. (2004)Kuittinen et al. (2004)
At2g28700dAt2g28700Indel55TGGGAACATGGGAGATTTTGTTATGTGTCTTGCCCTTCACTGAAAAAGAG
nga361T16B12MicrosatBell and Ecker (1994)Bell and Ecker (1994)
At2g33010dAt2g33010Indel55TGGAGCATATCGAGAAGAAGCACTCGGACTTCTTGTGAAGGCAAATCAGA
ACT3At2g37620MspIKuittinen et al. (2004)Kuittinen et al. (2004)
ICE12At2g39010MicrosatBell and Ecker (1994)Bell and Ecker (1994)
At2g40140At2g40140Indel50TCAAAAACCCCAACCACTTCTCCACCGATGGATTCTCTTC
At2g43010At2g43010Indel50CGGACTCATGGACTTGCTTTTTCTGGGTTTGGGTTTGTTC
ACA/CG-130AFLP
ICE11F11C10/F13A10MicrosatBell and Ecker (1994)Bell and Ecker (1994)
MTP1-AAt2g46800RFLP/SSCPDräger et al. (2004)Dräger et al. (2004)
Linkage group 5
nga1145T16F16MicrosatBell and Ecker (1994)Bell and Ecker (1994)
At3g28220At3g28220Indel50TGGGTCCATTTCTTGTTGTTCCAAGCCAATTGCTCCATAG
At3g33530At3g33530MfeI50TGGTGGGATGTAACAACAGGTTTAGACTGGGGCACAAAGC
AAC/CG-179AFLP
At3g45810At3g45810DraI50TTTGCTGGTTATTGCCTACGACCTCTCGCTCTTGTTTCCA
F3HAt3g51240HindIIIKuittinen et al. (2002)Kuittinen et al. (2002)
MTP3cAt3g58060Indel55CCATGGTCACGGTCATAGTCATCGCTCTGTATCGAATCTCCCAGCA
nga112At3g62650MicrosatBell and Ecker (1994)Bell and Ecker (1994)
Linkage group 6
At4-GA2T18A10Microsat50CCTCGGGTAAAGACAGAGCATGGTAACACCGGAAGTTTCA
LDAt4g02560IndelKuittinen et al. (2004)Kuittinen et al. (2004)
MTP1-BRFLP/SSCPDräger et al. (2004)Dräger et al. (2004)
AthDET1At4g10180MicrosatClauss et al. (2002)Clauss et al. (2002)
ICE2K18P6MicrosatClauss et al. (2002)Clauss et al. (2002)
AthCDPK9MQM1MicrosatClauss et al. (2002)Clauss et al. (2002)
AAC/CG-336AFLP
ACA/CG-359AFLP
At5g08160At5g08160Indel50TTGTTGGTACGACTTTTTCTCGGCCGGATCCTTGACTTTCTT
MT2bRFLPZhou and Goldsbourgh (1995)Zhou and Goldsbourgh (1995)
Linkage group 7
At4g38220At4g38220Indel50GTGGTGGTGGGAGAAGAGAGACCGTGTTGATTCGGAGGTA
At4g33160At4g33160Indel50TTGGCCTAAG TTTTTCTTTTTGGTCATCCATGGGGAATTCAG
cha15fF11C18Microsat50AATTCAAACAGGCGAAACCACTGCGAATCTCACGACTTCA
TSB2At4g27070IndelKuittinen et al. (2004)Kuittinen et al. (2004)
At4-TC1T19F6Microsat50CAAGGTCGAATGTTGGAGACTGCGCACTACAAAAATGAGAGG
SRKgAt4g21366SNPTCAAGATTGAAGCTGAGTGATACACAACCCGTCCCGCCAA
FCAAt4g16280HinfIKuittinen et al. (2004)Kuittinen et al. (2004)
ACA/CG-266AFLP
ACA/CG-312AFLP
PhyCAt5g35840IndelKuittinen et al. (2002)Kuittinen et al. (2004)
ATTSO191At5g37780MicrosatClauss et al. (2002)Clauss et al. (2002)
ICE9At5g40340MicrosatClauss et al. (2002)Clauss et al. (2002)
Linkage group 8
ATCLH2At5g43860IndelKuittinen et al. (2004)Kuittinen et al. (2004)
ACA/CT-86AFLP
EMF2At5g51230XhoI54GTTGCAGTTTGCAAAAACGACATGGAATGTGACCATCTGC
ACA/CG-387AFLP
MHJ24MHJ24MicrosatClauss et al. (2002)Clauss et al. (2002)
NRAMP4eAt5g67330Indel55TTGGATGTTTGGTCAGACGAAACCCAGTGATAAACTGTCCGGCGTACGTACCTGTGAT
  • The names and identification of the loci in A. thaliana, the type of polymorphism scored, restriction enzyme if a CAPS marker, annealing temperature, and primer sequences if newly defined markers are shown.

  • a Primers provided by T. Mitchell-Olds (personal communication).

  • b Primers and genotyping results provided by M. Mirouze (personal communication).

  • c Primers and genotyping results provided by M. Hanikenne (personal communication).

  • d Primers and genotyping results provided by F. Varoquaux (personal communication).

  • e Primers and genotyping results provided by R. Oomen (personal communication).

  • f Primers provided by C. Schlötterer (personal communication).

  • g A. halleri allele-specific primers are given, and genotypes have been controlled by amplification with A. l. petraea 1 allele-specific primers (V. Castric, personal communication).