TABLE 1

Attributes of genetic markers

Marker nameTemplate sequence accessionno.TypeSequenced BAC accession no.Linkage groupPutative function or probeRestriction enzyme or fragmentsize (bp)MethodA17 restriction fragment patternof CAPS or SNP positionA20 restriction fragment pattern of CAPS or SNP positionForward primer sequenceReverse primer sequence
11B2RAZ757871BESTAC144473.36Resistance gene analogBglIICAPS414192 + 222AATCTTTCTAGCCAATGTAAATCTTCAATTTTGCGAAAATTGGATCTAATGGGTTC
11N15LAZ757877BESTNA6Resistance gene analogNADominant4000AAGCTTGAATCCACACTATTTGACCCGATGCAAAAACCAGGAAAAGAAGAAT
11N17RAZ757879BESTAC144502.34Resistance gene analogMnlICAPS100 + 327427CTACTCCCTGCACCTAACCATTCACGGCACAATTATTCATCTCTTCCCAAA
1109LAZ757880BESTNA3Resistance gene analogSspICAPS19742 + 155CATGGCATCCAGATCCCACATTATAGACTTAGCCCTCAAAGTATTTCCC
13B3RAZ757888BESTAC130653.16 AC135312.73Resistance gene analogBstNICAPS75 + 365440CTCGTTGTAAAAAAGCGTTACCAAACAGAGTATTCATGTTACACAAAATAAACGTCATTGAG
1433PAI974411ESTiAC144342.7314-3-3-like protein480SNPT/114/F
G/123/F
A/133/F
T/114/F
T/123/F
G/133/F
AAGGTTTTCTACCTTAAGATGAAGGGAGGTTTAGCAAGATTGCAGGCACGA
15J11LAZ757898BESTAZ7578981Resistance gene analogDdeICAPS190 + 72262GTGCCCCGCCCCTTTATTTGCAAATAGGCCCCATCC
15L4RAZ757901BESTNA6Resistance gene analogXmnICAPS155 + 363518AAATTTTAGAGACCTGAGACATTGGGGTTTTAGTTTACCATGACTTTGCTCCTCT
18A5RAZ757906BESTAC135396.176Resistance gene analogBsrICAPS350123 + 227AATGGAAGGCCAGAAGCATAAGTGTTGAATTGGACATTGAGTTTGGGA
18D24RAZ757908BESTAC130808.133Resistance gene analogSspICAPS211 + 82293CAATCCTGATCTACTTAAC CAAAATAACAGCGGATGAAAACAGAGAACCGTGAAACAC
18L14LAZ757909BESTAC135160.15 AC137667.84Resistance gene analogStyICAPS412180 + 232CGTAACATTCTCATTATCGCTGCTATAAGTAATCCGGTGATTGATTTTTCTCC
19D7LAZ757911BESTNA5Resistance gene analogClaICAPS212 + 49261AATTTCTTCCATTTGTCTTGTTTTGAACAATCGTGGTCTCTGAACATATTTGG
19F14RAZ757913BESTAC137508.63Resistance gene analogBfaICAPS157 + 318463AAGCTTACCTGATACCATTTGTATGTTGTAAACCTATTGCCTTTGTATTTTGAGATGG
19L13LAZ757914BESTAC133863.153Resistance gene analogMboICAPS113 + 135248TGTGTACAACAACAACAAGATAGAGGAACATTCCATGGTTAAATGGAAGTAGTAACTGCTCC
1904LAZ757915BESTAC135396.176Resistance gene analogHindIIICAPS297 + 138435GGGAATGATAATGGTATGTGATATGAAAATGCTATGCCAGACTGCCTCCAATGT
1E19LAZ758056BESTNA6Resistance gene analogAlwICAPS325136 + 145ACCCGGTGCGAATGTAATGAGCAATGCTTGCCAGAACTCCA
1N1RBH001061BESTAC136472.152Converted AFLP markerBsmAICAPS500200 + 300CATATTGTTAGATTTGTGGGTGAGCGTTAAGTTGGTAGAG
21L20LAZ757924BESTNA5Resistance gene analogBsrICAPS292105 + 187AGGTGGAAAAACCCAACGAGAATACTGCAAATAAACCCTCTAGAAAAGTCTG
23L16RAZ757931BESTNA4Resistance gene analogNADominant3000CAAATTCTCAACCCTTCTGCTCAACTACTGAACCAAATGAGCCGAACTTGAGCT
24D15RAZ757932BESTNA3Resistance gene analogHpaIICAPS180 + 70250AATAATTGACGAGCTACCAGCATATGTGGATTTGAATGTGATCTTTTGATTAA
25A23LAZ757939BESTAC144502.34Resistance gene analogNlaIIICAPS76 + 30476 + 59 + 244TTTTATTTCGCGTTGTTTATTTGATTCACGCGCAGCAGCCATCC
26E21LAZ757942BESTNA6Resistance gene analogDraICAPS120 + 297417AAGCTTCGTGCCATTGGTGAATACAAAGCTTCGTGCCATTGGTGAATACA
26G3LAZ757943BESTAC130653.16 AC135312.73Resistance gene analogRsaICAPS116 + 268384TTCTGACCAATCCGAAGAGCAGTGATGGGGTTAGATTTTAGTTACATGTTTGACACA
2M10LAZ758065BESTNA8Resistance gene analogDraIIICAPS282152 + 130TATTTGCTCCTAGTTTTGGGTCAAGAAGTTAATGATTTTTCACTTGCAGAATAAG
2M10RAZ758066BESTNA8Resistance gene analogNlaIIICAPS78 + 18378 + 61 + 122ACAAAGGGTCTGGGCGATGACACCCTGATTTCCCGCAAGTGA
33I23RAZ757960BESTAC121243.102Resistance gene analogBstUICAPS329214 + 115CTCTTCATTTATGAGTGTACTTGTCTTTCCATGAATAGCCGTGTTTTGGTGG
34D20LAZ757963BESTNA5Resistance gene analogHpaIICAPS50 + 200250CTGTTTTGCACTGATATTGTTAGGAAGATGCTATACAGAAAAGAGGTGGTGATTATA
36N1LAZ757974BESTNA6Resistance gene analogBglIICAPS277 + 129406GAAGCAGCCGGACATTGGACACATGTTAGTTCAAATGGATCTTCTATGAGGTAT
38K1LAZ757981BESTNA3Resistance gene analogAflIICAPS39 + 210249GGCTGGTATGAAAGAAGAGCAGAAAGTTTAAATAAGGACCAGGATGTTCG
3F12RAZ758069BESTAC134823.126Resistance gene analogRmaICAPS178 + 207385CCAGAATTCTTCGGTTGATGATGTTTTGATAAGGGGTGAACTAATTGTGATGACTCTTGA
3F15RAZ758071BESTNA3Resistance gene analogBstUICAPS47856 + 422ATGTCACGAAAATAAGCATACAAATCCTTCGTGATGTTGCTTCCAGATGAATGTGG
3N6LAZ758072BESTNA8Resistance gene analogXhoICAPS154 + 73227AAGAGACTTAAGAATTTTCGATGGGATGCACTTGGGTTGGTCTGATGGTGCTG
40H12LAZ757985BESTNA8Resistance gene analogBsrICAPS280152 + 128GAGCTGGAAGGTTTATATAAATATCTGCCCAAGAGAAATGAATTGTCTTATGTCTGTGTGTG
40L12RAZ757988BESTNA3Resistance gene analogNlaIIICAPS30296 + 206ATGACATACTTCAAGAAATAAACCACCAGATCCAAATCCCATCTCCAACAGG
41F23LAZ757991BESTNA5Resistance gene analogBsmAICAPS195103 + 92CCCCCGCATGTAAGGATGTTTCGCAATTGCAACTTGTCCAC
41018LAZ757993BESTNA4Resistance gene analogAluICAPS268167 + 101AGATATATCAGAAAAAACTAACCCAACCTTAATACCCTTCCCTTTCCTTCCC
42J16RAZ757996BESTAC144341.103Resistance gene analogHincIICAPS227 + 242469ACCTCTTCTATAGAGATAACTTGTGTAGCAAGGATAAACTGGCATTCCATGACTTTCA
43I21LAZ757998BESTNA4Resistance gene analogNlaIVCAPS147 + 232 + 4545 + 379GCTTTTGTTTTAATGCATTTCTTAGTGTTTCTGGAGCCTCATGTGTTTCAAACG
44D11LAZ757999BESTAC138199.56Resistance gene analogAseICAPS481170 + 311TCTTACAAACTACAATATCACAGAGGACTAAACCAAAATTATTATCATTTGGTTAGCATTA
48N18LAZ758017BESTNA6Resistance gene analogBsmAICAPS510130 + 380TCTTTTCCTCCGATTTCTTGATTCTCAGGCTTGCTTGCTGTTGGTTGTA
50O1RAZ758020BESTAC126790.206Resistance gene analogNADominant3000CGACATCCCTTACATGTTGCCACTTTTGCGACCATGGAATTTGTGAGGA
51J1RAZ758021BESTNA6Resistance gene analogHincIICAPS233 + 163396CGGTTGCAGGGGTCAAATGTAATCGGTTGCAGGGGTCAAATGTAAT
5J9LAZ758081BESTNA3Resistance gene analogHinfICAPS359235 + 124TCCTTTGGGAAGAATGGTAGAGGCTCTGAAGAAGTATTTTCCTTCCTTGAC
6M23LAZ757852BESTAC142223.43Resistance gene analogMseICAPS50 + 265170 + 95 + 50GTTAGTTTACCACTTTTGAGTAGTGTAAGCACTTAATGTTAGAGATTGAAGGTGAGAGAAAC
7405RAZ758032BESTAC144341.103Resistance gene analogClaICAPS228131 + 97AGTTCATTACTTGATTAGCACACTTGTACAAGTCTAGAATGGAA CACGTTGTTTCG
75D1LAZ758033BESTAC124955.214Resistance gene analogNlaIIICAPS220 + 43263AAGCTTCCAATGATAGATGATCGTAGATGTGGTATCATTAGTCCTTCTCATCAGG
78B21LAZ758038BESTAC134824.156Resistance gene analogNALength380300TTAGAAATTGAAAAGCGTGTATGACCTTGCGATGGTGTCAGAAATGT
79H20RAZ758047BESTNA5Resistance gene analogNADominant3800GCTTCGTGAGGTGATAGATCTAGAGATGACTGTGCTCATGTTAATTGGTTTGGTGTAT
79P21RAZ758049BESTNA6Resistance gene analogDdeICAPS211 + 298211 + 87 + 200GCTACTGCAACGTTCCCTCTCACAGTCTAAATATGCGTGGTTGTTCTAAAGTGTT
7G13RAZ757859BESTAC123574.206Resistance gene analogRsaICAPS356292 + 64AATTGCACATATTTCATTTGAGTTGAGAAGTTTCTTCTTATAAAAAATGGTGAAGTATTGTG
7H15LAZ757860BESTAC134049.145Resistance gene analogAluICAPS30 + 250280TTTCATCTTCTGCCTCATTTGGTCGCCTATGGAGGTGAGGATTTGG
8C10RAZ757865BESTAC126790.206Resistance gene analogBSPHCAPS387243 + 168TGCAGTCTCGAGTACAACAAATGAAATTCTCGGGTGGTGATGATGACTCTG
AA661025AA661025ESTiNA8Resistance gene analogEcoRVCAPS351 + 277628CAAACCATACTTAAGCAAACCTACAATGCCTTCGGACCTTCAGCAAAACACAG
AASAW171678ESTeAC129091.112Acetolactate synthase precursor400SNPC/257/FT/257/FGATGGTGATGGAAGTTTTATGATGAAACTTATCCTGCCATCGCCCTCGGTTA
AATAA660344ESTiAC126783.105Alanine amino-transferaseApoICAPS500 + 500300 + 200 + 500TGCTTCACGATGCCACCAATCCGACATTAGGATCATCAAGTAGG
ACCOAI974230ESTiAC121236.14 AC122163.1621-ACC oxidaseMnlICAPS29040 + 250GAAGATGGCGCAAAAAGAAAGTCGATGTGTCGTGTCATCTCGTTAAGTTCCCT
ACLAA660349ESTiAC132565.82ATP citrate lyaseBclICAPS30 + 270 + 9001200AAGGTTAAGACCGTATTTATTCCAACAAGTCCAAATTCGTCCCCACTG
AGTAW126002ESTiNA7Putative 4-α-glucano-transferase1000SNPC/303/F
G/304/R
T/303/F
A/304/R
GATTTGGGCCTCATTCCTTCTTGTGTGCACCTGAAGGGGGAAAATTGCCCACATTGA
AT974451AI974451ESTiNA8Resistance gene analogHphICAPS470400 + 70CGATGGGTTTTTCCAGTTTTCTATTACAGCAACAAGAGTCAAATTCAGTTCCA
AT974519AI974519ESTeNA2Resistance gene analogNADominant3000GCTGAATTAGTAGGCTGGGATGTCCTATGGTTTGCCGAAGGATTTG
AIGPAW125928ESTiNA3Auxin-independent growth promoter460SNPG/99/RC/99/RCTGATAGGGCCAGGAGGCAGGGAAGAGTTTTTTAGCATTTGGACGAATGGTTGGT
APXAA660806ESTiAC121235.164Ascorbate peroxidaseSpeICAPS2000650 + 1350ATCTTCGCCATTTTCCTTCTTAGGCTTTGCCAAACACATCCCTC
APYR1AA660474ESTeNA7Mt apyraselAluICAPS95 + 38143AACCCTTGCCTTTTGGCTGGATTTGATGGTCTGAAATTATCATAGCCGAAATAGTGTG
ASN2AW208061ESTiNA5Asparagine synthetase400SNPG/103/F
G/152/F
C/103/F
A/152/F
TAAAAAAAGATGAAGGAC GAATTGAGAAGCAAAGATCATTCTGTAGTAGTATGCTTCCT
ASNEPAW208187ESTiNA1Asparaginyl endopeptidase700SNPA/239/FT/239/FGAAGAAAAAACATGCTTCTGGATCATATAATCTTTAACCAATTTATATTGCTGGTGCA
ASPPAW126301ESTiNA7Aspartic protease precursor900SNPC/250/FT/250/FGGTGGTGAATTAGTTTTTGGTGGTGTTGAAC ATAAAC CAACTTGTGAACAGACGTCA
ATCPAW207998ESTiNA3Aquaporin-like channel protein900SNPG/290/RA/290/RAACCAATTGGTATTGCAGCTCAGAGCCATTCCTTGCCAAGAACAAACCGAATGTCA
ATP2AI974613ESTiNA1ATP synthase β-chain, mitochondrialprecursor>1000SNPA/58/F
T/273/R
C/442/R
C/58/F:/
273/R
T/442/R
ATTGCTATGGATGCTACTGAAGGTTTGTGGTATGGTGCAAGCAGGTCAA
AW125982AW125982ESTeAC134049.145Resistance gene analogMboIICAPS133 + 166299GCTTCAACCTCATTCCCAACAACTTCCCTTACCAGGTCTGGCAACTTCTCTAATATC
AW256557AW256557ESTeNA1Resistance gene analogAlwNICAPS334300 + 34GATATTTTCATTACTCAGCAACTTTTTCACAGTGCTTCATCCCACTTATCATCAATACC
AW256637AW256637ESTiAC144658.44Resistance gene analogScaICAPS525404 + 121TTCAC CTAATTTCCATCTATACCATCCATGTTATTTGTTAGCTTTAGTGATCGCTGCTACAC
AW256656AW256656ESTiAC125480.204Resistance gene analogBsmAICAPS505190 + 315CCCAGACAACATTTCCTTACTATCGTCACCAAGTAGTAGGCAAAACCCAACAAATT
AW257033AW257033ESTeNA8Resistance gene analogMboIICAPS314260 + 54TGCGTCATTAACCAAAGATGATGTTGTAACCAACAGTAACATCCCCAAAGACAATATTC
AW257289AW257289ESTiNA4Resistance gene analogBsmAICAPS341 + 137478CTTCGGACCTTCAGCAAAACACAGCGGGTGACAGATTATTTGGTGACATC
AW684911AW684911ESTeAC137825.176Resistance gene analogNADominant3500TCTAAAC CAAGTGGGGAGTATCGCGTGTTATTATGCCAAGGAGTTTGATGT
AW688464AW688464ESTeNA3Resistance gene analogNADominant3500TGATTTGAAGGCATGGGTTTGTGTAAAATTGAAGTCCACTCTGTTATGTCTAC
AW696588AW696588ESTeNA6Resistance gene analogNADominant4000GATTCCCATATTTTCTGCCAACTATGCATCATCAGGTCCCTCATCAAGAAG
AW696680AW696680ESTeAC144502.34Resistance gene analogNADominant3500GGGAAGACAACTCTGGCTACTGCTGTCATATGTCAAACTCCTCATAATCACT
AW736136AW736136ESTeNA7Resistance gene analogNADominant3800ATCTTCCAACCCT CATCATCAAT AGAATAGCCCAAAGAA TAGATGTGAA GCT
AW736703AW736703ESTiNA3Resistance gene analogTaqICAPS160 + 290450AGCAAGGTATTCAACTTCTTTTCATCTTGCAAATATTTCTTACCAGTTAGTTTGTGC
AW774053AW774053ESTeNA3Resistance gene analogHindIIICAPS365250 + 115CCGGGTAGTAGGGTCATCATTACACACAGCCATTTTATTATCTCCTCTCAAC
AW774849AW774849ESTeNA6Resistance gene analogEcoRVCAPS25882 + 176TGAAAGTCACGGGGGAGCACAACGGTGGATTTTATGATGGACTC
BADHAW126256ESTiNA4Benzyl-alcoholdehydrogenase700SNPA/226/F
C/58/R
G/226/F
T/59/R
GTGATGATTGGACTGGCACAAGCTGTACAGCCCGACCGACTATTTTTCCT
BE187590BE187590ESTeNA3Resistance gene analogBamHICAPS37080 + 290ATGCGGATAGAAGGGCTGATGACAATTGTCCGGTCTGCTCTTCC
BE325283BE325283ESTeNA6Resistance gene analog Bsrl CAPS72 + 275357GTCCATCAATTTCAATGTTCCTGTTTTCGCATTCAATTCTCTTCCTTGC
BGALAW126229ESTiNA1β-Galactosidase600SNPC/130/F
A/362/F
A/130/F
G/362/F
AGACTTGTCTTGGCAGAAATGGTCTTACAAATATGATACCATTTCTGTGTTGGTTCTCCA
BiPAAW125959ESTeNA4BiP isoformA400SNPT/284/FC/284/FGAGGAGTCTCACAAAGGATTGCGGTTTTTCATGTTGTAGACATAGGTTTCA
CAFAA660318ESTeAC136449.98Caffeoyl-CoAO-methyl-transferaseBsiEICAPS19530 + 165AATTACAACCAGAAATTAAGTATTCGACCTGGAAATTGGTGTCTACACTGGCTAC
CAKAA660544ESTiAC135795.37Calcium-dependent protein kinaseApoICAPS345 + 200 + 210 + 110545 + 210 + 110TTCAACCCCTCTGCGAACCCATCTATAGCAATTGCTGTTGTCATCT
CALTLAW126242ESTiNA1Calreticulin440SNPC/108/F
A/199/F
C/287/F
A/340/F
T/108/F
T/199/F
T/287/F
G/340/F
GTGGAAGGCACCATTGATTGACAACTCTTCTTCTCAGCCTCTTCAAATGC
CDC16AI974470ESTeAC121241.158Cell division control protein 16AlwICAPS260210 + 50CCTCCCGCTTCACTTCACTTTGGTAATGGTGGCCGAGGAATA
CDC2AW171750ESTiAC144481.31Putative cdc2 kinase820SNPT/310/FC/310/FCAACTTTGCAAGGGTGTTGCTTTCTACTAACACCTGGCCACACATCTTCA
cgO008FESTi2Gibberelin 3 β-hydroxylase,Vr AZ254216400SNPT/113/F
T/248/F
C/113/F
C/248/F
TCGCTCGTATCTCTTCCTTCTTCCAGTTTGGCCATTAGTACCGTCACC
cgP137FAW257467ESTeNA1Unknown protein400SNPT/354/FC/354/FTGTTAACCTCAGTTACTGCAACAGAAGGATGCAATCAAGCATATATCTTGA
chitlY10373GSAC121239.123Mt Chitinase INALength9895GGTAAGGTAATGCTCTATCTTAATCCTTACGGATGAAAGGTATTGTTTCC
CNGC4AW126067ESTiNA8Cyclic nucleotide-regulated ion channel380SNPT/197/F
G/201/F
A/282/F
A/197/F
T/201/F
G/282/F
AGAGATGAGAATCAAGAGGAGGGATGCACATGATGAAGAGCATTTCGTCCACTGGA
CoA-OAI974546ESTiAC119408.58Acyl-CoA oxidase (ACX1)ApoICAPS10 + 410 + 60 + 21010 + 410 + 270TTTGGGGGAAATAATGGAAGTCTCTCGGGCAATGTTGAAAAATC
CP450AW171693ESTeNA4Cytochrome P450310SNPA/134/F
G/152/F
T/158/F
G/134/F
T/152/F
G/158/F
AGTGTGAGATCAATGGTTATGTGATCCATCATCACCTTTCAATATTTGTCC
CPCB2AW191283ESTiNA2Putative coatomer protein complex, β2600SNPT/420/FA/420/FAGAAAGAGTGAAGTCTGTGGATCTACATCGGATGAACAGCCACACACCTAATGTAATC
CPOX2AW127442ESTeNA8Cationic peroxidase 2300SNPA/100/RT/100/RGATAATGGCCTTGTTATGAATTACTACAGCTCAGACAAGCTTCTTCTTGTGGA
CrSAI737624ESTiAC122724.136Cystathionine-gamma-synthase precursorNALength750950CAAATGGTGCTTTGGAGATTGATTTAAAAAAGTAGACTGAAGTGTTGACCA
CTPAW126130ESTeNA2Putative carboxyl-terminal peptidase300SNPG/80/FA/80/FGTTTCGACCCGGACCACCATAATAGAAGTATGGAAATGACCATGTTCTAGGATACTGGC
CYSAA660257ESTeAC139601.47Cysteine synthaseApoIdCAPS30 + 21030 + 55 + 155CGAAGCATATTTTTATTTACAGCRTCTCAC CTTAATATTGAATTGCATGTGAAAGT
CYSKAW207985ESTiNA5Cysteine synthase400SNPG/305/FA/305/FGGAATTGCTAAAGATGTTACAGAATTGAAATGAGGACACTCTGTCCAGGTGTGA
CYSPAW125930ESTiNA1Cysteine protease500SNPC/233/FT/233/FAAAGGACTATGCTTACACCGGAAGAGACACATACATTTCGGCCTCTGCAGATCT
CysPrlAI974595ESTeNA3Cysteine proteinase-like proteinAclICAPS23060 + 170GAGAATTCAAAGAAGAAATTAAGACAAAGAGAAGAATTCATGGGGAGCAAAGT
CysPr2AI974635ESTeNA1ThiolproteaseSpeICAPS24030 + 210CCAAAAACTTGCTTCTATACTCTTCATTCGACAAAACCCACCCAGACAAATCAACTAG
CYSSAW127154ESTiNA5O-acetyl-l-serine (thiol) -lyase640SNPT/232/F
T/254/F
G/394/F
A/232/F
C/254/F
A/394/F
CTGATGCAGAAGAGAAGGGGCTTATCACCAATTCAGCTCCAAAAGCTAATAGAATGA
DENPAI974308ESTeNA4Dentin phosphoryn [Homo sapiens]NALength195222AGAATTGGACTTCTTCTCACTCACGCGGATGAAAAGCCTGAAGATAAGTC
DK003RAQ841082BESTNA5Pea-PTO-like kinaseNALength350900TCTGCGGTCATGAGGTGGTTGATATATAGGTGATTTGGTTTCTACTAA
DK006RAQ841074BESTNA5Pea-PTO-like kinaseNALength450420GAACATAACCCCGAAGTGGATGAGTTTGGGAACAAAATTAGTATGAT
DK009RAQ841079BESTNA5Ms-syntaxin-CG13DraICAPS450280 + 170TAGCATCATCTTTCCCATACAAGGGCAGGCAGCACCAGATA
DK012LAQ841080BESTAC140772.7 AC137509.95Mt-rRNA geneDraICAPS200 + 30230AGCTTCTTTCCATTATTCCTTCCGGAAAGTTAGGGGTGCTAAAACTTGCTTTTTAA
DK013LAQ841055BESTAC140772.7 AC137509.95Mt-rRNA geneRsaICAPS110 + 300410AAGCTTATCTATGCCATCTCGTTCGAAAATGGTTACTTTTAAGATGC
DK015RAQ841060BESTNA5Ms-U224-1NALength10090ATTTCACGTGTATGCAAGATTATATGCATCATATCTTCACCCAAAGTCTTA
DK018RAQ841066BESTNA5Ms-U492NALength230220TGATACATGTGGGAGCCTTGAAGACTGCATTTGGTTCGGATGTATTCG
DK020RAQ841084BESTNA2Mt TL4 probeNALength140150TCCATATTCAAGCCACCAATTCCCATATACAAAATGTTACACTAAAACACGATA
DK024RAQ841087BESTAC139670.104Mt-TL4 PCR productBglIICAPS440130 + 310GCCGCGCCATCTTTATTGAGACGATTTTACCCTTTATCTAAGC
DK039RAQ841114BESTNA5Pea-PTO-like kinaseDraICAPS370 + 80450CAATTACTAGATCTATTTTATTTTCAAGCACCACAAGCAGAGGGAGGATAGT
DK043RAQ841097BESTNA4Mt-expansin IRsaICAPS40 + 310350GGGACTAATTAAAAGAGAGAAAAAGAAAACGCGTGAGCCTCTTGAGCTTGATGC
DK045RAQ841099BESTNA2Mt-chitinase IIIHinfICAPS60 + 270330TGGCAATATCCACCAAATCAAACGAACCCACGACCACAAGG
DK049RAQ841103BESTNA1Mt-chitinase IIINALength400370GTGATTCTCATGTGCTCTGATGCCGTTGGATAAACCCTAGACAAGATATT
DK103LAQ841172BESTNA4Mt HistoneH3BglIICAPS43080 + 350GAAACTGCGCTGCTCTGGAATCTCTCGATCCCAAAACGAAAACTCC
DK128LAQ841726BESTAC123571.55Mt EST-AA660812BsmAIdCAPS330300 + 30AAAGTCGTTCCCCTCATTGTTACATATTTGAGGAGCGTTATTCTTTGCTAGTC
DK132LAQ841734BESTNA3Mt EST-AA660521XmnIdCAPS320290 + 30TGGACCTAAGACTTCAAAGATTCAGACCTATTAAGCATATTTGCAGCATGAACAATTT
DK139LAQ841733BESTNA5UnknownEcoRVCAPS260130 + 130CTAGCAAAACTCAGAAAAC CAAGAACGTTTTAGAGGAAATATGATGAGCA
DK140LAQ841738BESTAQ8417381UnknownAlwNICAPS13929 + 110ACCATGGCCAATGCGAGTTAAAATGAATCTGAGCTTGGTAACGCCAGTAT
DK201RAQ917159BESTNA3Gm RFLP-A352, AQ841755, AQ842022DraIIIdCAPS11030 + 80GGACGCGAGAAATGGCAAACAGACTATTGGTGATTTCATTGCACGAAGT
DK202RAQ917161BESTNA3Gm RFLP-A352, AQ841755, AQ842022NALength285300CTGTATTTATCTCCTTTGCGAGAATGTACAAAATGATAATTATGCACGTAAAAGTAAG
DK224RAQ917190BESTAC139355.57Gm RFLP-A235, AQ841798, AQ842064EcoRIdCAPS80 + 30110CGAAACAATAATCACAAAACAAATCAGATCTTGTTTATATGTGTTTGTTGAAGACAGAATT
DK225LAQ917191BESTNA7Gm RFLP-A235, AQ841798, AQ842064NcoICAPS27060 + 210TGTCCTTGCTTCTTATCCTTCCTTCAAGCAGCACAACAACTTACAACAACTC
DK229LAQ917196BESTNA6Gm RFLP-A235, AQ841798, AQ842064StyICAPS250200 + 50TGGCAAGTGGAGGAGAAGACGACCAGCCAGAAATCGAAACAGAA
DK236RAQ917202BESTAC122726.178Gm RFLP-A381, AQ841805, AQ842052MwoIdCAPS12525 + 100GCAATTTAAATGTAATCCATTGAACCAGTATTGTATTGTGAAGGGCATTGCTACTA
DK238RAQ917205BESTNA2Gm RFLP-A315, AQ841810, AQ842017SacICAPS50 + 250300GCAATTTAAATGTAATCCATTGAACCATTATGCTTCTGATTCTAACTAACCCCA
DK242RAQ917211BESTNA5Gm RFLP-A947, AQ841815, AQ841993HincIICAPS230 + 100330CGTATGTTTAATCCGTTAGTCCGTCTTGCTTGCTTAGATATTTGGCACTTCA
DK258LAQ917077BESTNA3Gm RFLP-K007, AQ841948, AQ842189XbaICAPS470100 + 360GTATTCAGGGATTGAGTAAGAAAAAGGAACAAAATCCGTGGATGTATAAAAGTGTA
DK264LAQ917083BESTAC127167.164Gm RFLP-A688, AQ841912, AQ842149BsrICAPS290 + 110400GGGGAGTGTTGAGATATGCGTAATTGATCGAGGAACCAAAATAAAGAAA
DK265RAQ917086BESTAC126783.105Gm RFLP-B139, AQ841929HincIICAPS50 + 140190GTGTGTCTAATAGAAATGAATGACGAAAAAATTACATTTATTTCCACTGCCTAATCAAC
DK273LAQ917094BESTNA3Gm RFLP-K300, AQ841961, AQ842203BcgICAPS30 + 100 + 220350TATGCCTGGTCTGTTCTTTCTTTACGGCCCGTCCACCGCTTTTA
DK274LAQ917096BESTNA7Gm RFLP-K390, AQ841966, AQ842113NADominant3800TGCATAAGCTCAAAAATAAGTCAATCCAGTAGATAAGCCCACATAAGCTCAAAATA
DK277RAQ917103BESTNA2Gm RFLP-A748, AQ841917, AQ842154MnlIdCAPS35 + 165190CTCAAATTCTCTAGTTTCAACATGGTATCAGGGCTGTAGTATTTAT AC CTGAGTTAGTGAG
DK287RAQ917123BESTNA7Gm RFLP-K390, AQ841966, AQ842113DdeICAPS270135 + 135AGCCGCCCTCTTGAACCTCCTAGCTGCAACAAAGAAACCAAAACC
DK293RAQ917133BESTAC121246.192Gm RFLP-A748, AQ841917, AQ842154DraICAPS80 + 210290ACTTACAAGGTTAGCGTCATTCTCCATCGCTATCCCACCTTAAAATTTCTTCACAA
DK296LAQ917136BESTNA7Gm RFLP-K390, AQ841966, AQ842113NALength380670GAAAGGATGAGAAGCGGGGATACTCGTCGATGAAAAAGTACCAATAGAA
DK297LAQ917138BESTAC124609.122Gm RFLP-A656, AQ841906, AQ842143XbaICAPS350310GGGAAACACATGAGCGAAGGAGTGCATAGCAAAACCACAATCTAACCA
DK298RAQ917141BESTAC126783.105Gm RFLP-B139, AQ841929Bsu36ICAPS430215 + 215ATAAGATAAGGGCCAACATAAGTAGAAAAGAAACTTGAGAGTGAAGAAAGTGATAGAAC
DK302LAQ917144BESTNA7Gm RFLP-A681, AQ841814, AQ842066AseICAPS30 + 200230GCATGGAAATAGTTTGGGTTAGTAGTTAGTCTGATAAATGCATATTTTCAACATATGAATTAA
DK313LAQ917231BESTAC122728.163Gm RFLP-A059, AQ841836, AQ842008NALength265240GCCAAACATAGGCTAAGTGTGAAAAATGACACATAAATTGTTAGCATCTGAAGG
DK321LAQ917245BESTAC122730.176Gm RFLP-A233, AQ841844, AQ842071MslICAPS120 + 250370GAGCGAGCTCAGGATAGACTTTAGAATCCCACCTCCAATTTGTAGACGAT
DK322LAQ917247BESTNA7Gm RFLP-A023, AQ841847, AQ842074DdeICAPS90 + 17590 + 30 + 145GGACCGAACTGGGTCAACAATGCACCGAGATCCACCAACAACTT
DK326RAQ917254BESTNA2Gm RFLP-A064, AQ841851, AQ842078DdeICAPS130 + 22080 + 130 + 140CCAGCATGTAAACAATTGAAAGGCAGTTGAACGGCTTAAATATCGCACTA
DK332RAQ917264BESTNA2Gm RFLP-A095, AQ841860, AQ842087DraICAPS90 + 120 + 14090 + 260GGAAAATTATAAGCCAAACAACAGTAAAGGATGATAACAATCGGGGAAAATAATG
DK340RAQ917278BESTNA1Gm RFLP-A636, AQ841903, AQ842140SwaIdCAPS230205 + 25GAGAGAGAGAAGAAATAGTTTGTTTTGCTTGTCTTTTTTTTAAGGAGTTTTTCTAGAGATTTAAA
DK347LAQ917286BESTAC 138449.82Gm RFLP-A063, AQ841754, AQ842009BsiHKAICAPS39040 + 350AGATTTCATACCAGACGGAGGATAGTTCTTTAGGTGATGGTGGCGTTGTTC
DK348LAQ917288BESTAC121242.157Gm RFLP-A572, AQ841760, AQ841986XmnICAPS12525 + 100TTGAGAGCTCGGGTCACATTTCCTAATGTGTAAACCCTAATGTTTCAACAGA
Dk351LAQ917294BESTNA8Gm RFLP-A110, AQ841767, AQ841975BfaICAPS50 + 280 + 140330 + 140TGCTTGGGCTTGAGCTTTTAGAACTGTTTGGGTATTAGTTTTTGTTGGG
DK353LAQ917298BESTNA4Gm RFLP-A110, AQ841767, AQ841975SphICAPS90 + 240330CCATGCCATGGAAGGGTGTTTGCAAGAAC CAGATACCCTTGACATTT
DK355LAQ917302BESTAC122165.245Gm RFLP-A135, AQ841786, AQ842014MslICAPS25 + 175200AACTAACTCTAAGATGCCACATTATAGGCTCAAAACATTCATCCGCCTATMCCACCTCA
DK358LAQ917308BESTNA2Gm RFLP-A363, AQ842067, AQ842107EcoNICAPS70 + 230300GTTTGCGCCACTTAAGGTTATCTCATTTGTCACCATGTGGCACATTCATT
DK360RAQ917313BESTAC131239.163Gm RFLP-A363, AQ842067, AQ842107MboICAPS45 + 305350AAGATAGTGCGCTGGTGTGTCATTTAGCCCATTTGTATATTTGGTCTTTT
DK363LAQ917316BESTNA4Gm RFLP-A006, AQ841823, AQ842006NADominant3800TTTGTTTTGTATGTATATGAATGGAATAACTTGGTTTAGGTTATGCCTTGGGAATGA
DK368LAQ917324BESTAC122171.121Gm RFLP-A450, AQ841842, AQ842069NADominant4200AGCTTGTGCACTTTTCCGTTTTACCTCTCTTAAGCTGCTTTATTTTTGTCTAT
DK369RAQ917327BESTNA1Gm RFLP-A450, AQ841842, AQ842069JVMVCAPS150 + 160310GGAACGTGGAGTTGTTGATGGTATTATGATGTAAAAACCTTTACACTTGATTGATTG
DK377RAQ917335BESTNA1Gm RFLP-A487, AQ841888, AQ842123BfaICAPS360 + 55 + 85325 + 35 + 55 + 85AGCAGCTAGCACGTGTCCTTTGACCGACTAATTATCAATATTGTCAACTACATCT
DK379LAQ917338BESTAC119416.144Gm RFLP-A487, AQ841888, AQ842123ClaICAPS50 + 40 + 80 + 70 + 17050 + 40 + 80 + 240AGCTTGTTGAGGTGGAAGGAAGTCGTGTGTATGAGTGTCGTAAGCCCCT
DK381LAQ917341BESTAC119416.144Gm RFLP-A487, AQ841888, AQ842123HinfICAPS250 + 8040 + 210 + 80TGTTACAAAAAGAGTTGGTTGTCGTTCGTGCACTTTTCAATTTGTCCATCATA
DK382LAQ917343BESTAC122162.193Gm RFLP-A487, AQ841888, AQ842123BclICAPS250220 + 30GGATGGAGAGGGACAGGAGGACTCTAAAAATAGCGAATGACTGACTGTGAT
DK407LAQ917366BESTAC1238982Gm RFLP-A086, AQ841762, AQ842011AluICAPS320250 + 70TTAATTTTATCAACCCACCATATTAGTCAACCAGTGCTGGAAAAGACAATCAATC
DK412LAQ917373BESTNA8Gm RFLP-A538, AQ841896, AQ842132BsmICAPS390170 + 220GCTGCATTCCTTCAAAACTTCATCACGGCGCCATTCTTCACCTTAT
DK413LAQ917375BESTNA4Gm RFLP-A538, AQ841896, AQ842132SpeIdCAPS170 + 30200TGATTGACCCCTGCTTTGATGCTGTCAGGTTTGTTGTTGTTTTTTCTTGCACTA
DK417LAQ917383BESTAC121232.163Gm RFLP-A685, AQ841911, AQ842148BbvICAPS410180 + 230ACTCGTCGCCTAACAATATCAACCAGGAATTCCATATCCAACACCTTTAGACTTA
DK419RAQ917388BESTAC121232.163Gm RFLP-A685, AQ841911, AQ842148NADominant4200CATCAGAAGTTGCCAAGCTATCAGAGGCTTTGGTGCCGTTGTCAGAAGTA
DK427RAQ917398BESTAC137986.87Gm RFLP-B046, AQ841833BsmAICAPS60 + 440500CCAAACAAGGAAAAGTGTTGGTGTCAATGAGAAACTTTTGAAATTTAGGATACGATAG
DK439LAQ917416BESTNA7Gm RFLP-K070, AQ841952, AQ842193BcgIdCAPS60 + 32 + 8100GCATTTTCTCTTGAACAAATTATAGTAGTCGCTCAGAGCAATAACACAGATCGATTTATTT
DK445RAQ917427BESTNA2Gm RFLP-K102, AQ841953, AQ842194PmlICAPS410350 + 60AAAGGCGAGCGACAGTAGCAGGACAGCACGCGACGCACAAATAACT
DK447RAQ917430BESTAC135160.1
C137667.8
4Gm RFLP-K365, AQ841964, AQ842206BglICAPS100 + 270370GTGGACGGCGACCACTTTGATGAGCAAATTTCGATTTACCCCTT
DK453LAQ917438BESTNA5Gm RFLP-K494, AQ841971, Q842118XmnICAPS150 + 320470GAGATCCGAAACAACGTCCAAAAATGGCACTACCCAACTCAGCAAACT
DK455LAQ917442BESTNA8Gm FLP-A060, AQ841826BspHICAPS330220 + 90AAGGTTGTGTTGCAGGCGGTTTTAGTCACATACAGAGTTTCCAGGATTACCATT
DK460RAQ917453BESTNA7GM probePvuIICAPS40 + 36040 + 160 + 200GTACCCGCACGCGACTTTTTCCATGGAGCTACATTCACAACACTTC
Dk473LAQ917474BESTAC122172.193Gm RFLP-A635, AQ841902, AQ842139BclICAPS130 + 230360AACTGGTTAACTCGCTAATTGCTACATACAATCCTAAACCTCCCAAAAAGC
DK490LAQ917504BESTNA2Gm RFLP-A611, AQ841776, AQ841988HinfICAPS350100 + 250TGGTTCCAAATTCCACTCAAAAGCAAAAATTGTGTTGTGGTTTAGTGGTAGAC
DK497RAQ917515BESTAC123547.142Gm RFLP-A073, AQ841751, AQ841973MseICAPS20 + 60 + 40020 + 60 + 110 + 290GGGAAAAAGCCAAAGGGAATGAAGAAATGTGAAGGGTGGTGGATAGGATGATA
DK500RAQ917521BESTAC141414.23Gm RFLP-A597, AQ841900, AQ842136ApoICAPS40 + 280320TGCAACAAAGCTTAAGAAATAGGAGATGGTAAGCCATCACACTTTTTCACAA
DK501RAQ917523BESTAC141414.23Gm RFLP-A597, AQ841900, AQ842136ApoICAPS200 + 220420TATTTGGGATGGAAGCTATGTTGATTGGTGCTTTAAAGGAGAAGGTAGATGATGAT
DK505RAQ917527BESTNA8Gm RFLP-B212, AQ841789, AQ842050AseICAPS200 + 180380GCCGCCGCTCCCAAACTTCAATTCCCTCCGGCGTCACTT
DK511LAQ917538BESTAC126779.105Gm RFLP-A702, AQ841800, AQ841991NALength400360TAAATCCGAGCTTCAAACCAACTCACTCCAAACCATACCCTTAATTACTGAGCAT
DMYAA660709ESTeNA6Putative proteinDraICAPS130 + 243130 + 66 + 177TCAAAGTCTCTTTTGCCGAACAACAATATAACAAATTTTGAGGTCTATGC
DNABPAI737524ESTiNA4SAR DNA-binding proteinAflIICAPS280 + 580 + 260860 + 260CCCTATGAGCTTGGGTTTGTCTCTCATGGCATACGTGTTCAGC
DSIAA660979ESTiNA1Disulfide isomerase P5 precursorSspICAPS510100 + 410CCAAGACATCTTTGGTTTCATCCACTGCAGAATCACTTGCCGAGTT
DSIPAI974248ESTiNA3Protein disulfide-isomerase precursor960SNPT/104/F
G/137/F
A/104/F
T/137/F
TCCTTCTCAGATCTTCGCTGAGGAATCACTTAATGGTTGGGAATCCCTTAACATCA
EIF5AAI974513ESTiAC122160.148Eukaryotic initiation factor 5A3DdeICAPS980360 + 620CGCGCAGAGAAAGCATCAACACAATTGTGGGACGAAGGAAC
ENOD16X99466GSAC136953.48MtENOD16MseIdCAP10075GTGTCCCGATGACACTATTTAAGGATTCAAGGACACTCTTCAAGCACACTTTAGATA
ENOD40X80262GSNA5Early nodulin 40NALength136177AACCAATGCCACTTTTCACTTTGCCTCCAGACTCTTGCGAGTGCTACCATTTGACC
ENOD8AF064775ESTiNA1Enod 8ScaICAPS900400 + 500CCATGCCCATTCCTACTTTTCAGTGGATTCCACGGACTTTACTTACT
ENOLAA660534ESTiNA7EnolaseSphICAPS450 + 10501500TTCCATCAAGGCCCGTCAGATTGCACCAACCCCATTCATT
EPSAA661012ESTiNA43-Phospho-shikimate 1-carboxy-vinyl transferaseBglIICAPS16201050 + 570GCTGTTGTGGAAGGCAGTGGACGACATACGGAACAGAAATCAGT
EST158AA660289ESTeNA2Vacuolar sorting receptor-like proteinBglIdCAPS18025 + 155TTACAAACCACACCATAATTGCCAAATTGTTGGTGACAACTGACACGAATGAAACTAC
EST400AA660514ESTiNA3UnknownSacICAPS500 + 5001000GGTGGCTGTCCCACTGATTATGTAAATGCTTGTGTTATGCGGAGAG
EST671AA660779ESTeNA8Hypothetical 71.3-kD proteinBglIdCAPS24020 + 200GGTGTTATCTATGAAAGAGGCCTCATTGGTGTCCTTGGGTATGTAGAAAAGCCTTCAC
EST718AA660824ESTeNA4Hypothetical 15.4-kDScaICAPS180 + 90270CGGCGGCATGCTTAGTGGTCTTGGAATGCCTTTGAATGAATA
EST758AA660863ESTeNA1protein Hypothetical proteinSpeICAPS23080 + 150TCACTTCCCCTAAATACGCTTCTCTTAATTTCAGCTGCCATTTCAAC
EST763AA660868ESTiNA1Hypothetical proteinHinfICAPS130 + 25155CACTCTAAAAAGGCCCAGAAGGTTTGACTCTTATGAC CAATAGTCTGTTCCACTC
EST948AA661051ESTiAC145021.54Hypothetical 33.4-kD proteinHaeIIdCAPS25 + 190215GCAGGGGTTTCGCTCCAGTGAACTTAATGAATGATTGGAAGGTTTAGCG
EXRNAI974855ESTiNA2Putative exoribonuclease910SNPC/160/RG/160/RGTTGGTGGTGGAAGTGATGGATCTCTGGAAACCTAGATATGTTCGGGTAAGATACTTGA
FALAA661005ESTiAC122727.135Fructose-1,6- bisphosphate aldolaseBclICAPS450110 + 340TTATCGCCAATGCCGCCTACAATGATAAGTATGCATGTTCAGAGTCA
FENRAW127593ESTiAC138010.95Ferredoxin-NADP reductase precursor670SNPT/28/FC/28/FATGCTTATGCCAAAAGATCCAAATGCCTCACAGCAAAGTCGAGCCTGAAGT
FIS-1AI974522ESTiAC122726.178fis 1 proteinBbsICAPS1280 + 90140 + 1140 + 90TCAGTGATTGAGGGTTTTTCTACGCTGTTTCATCAACTTCAGCAACTTT
GH1AI974251ESTeNA8GH1 proteinBsmICAPS21025 + 185GAGCAATCAGACAATCCGAGGTAGGTCTGTTTAATCTTTCTGCCAATGCATT
GH3AW125947ESTiNA8GH3-like protein530SNPC/337/FT/337/FCCTGTCTCGCAATGCAAACGTTGAATATCTCTAAAATAGGAACTTTTGTAATAGC
GLNAAW125915ESTiAC139882.33Glutamate-ammonia ligase540SNPT/184/F
T/314/F
A/163/R
C/165/R
C/184/F
G/314/F
G/163/R
A/165/R
GAATGGTGCTGGTGCTCACACATGGTGGTGTCTGCAATCATGGAAG
GL03AA660821ESTeAC137670.58Putative proteinHincIIdCAPS210 + 30240TTTACTTTTGATTCATGAATTAAGCGTGTCAAGTGATAAGAATTTGGAAGTTAGAACCTGAT
GLUTAI974518ESTiNA8Putative glucosyl transferase>1000SNPA/209/F
T/213/F
G/209/F
A/213/F
TACAAGGCAGGGAATCTTAAATCTGCATTATTCTCCAGACACCAGCAGTTCCA
GSbY10268GSAC139882.33Glutamine synthetaseHindIIiCAPS130 + 50180CTATGAGAGAAGATGGTGGCTATGAAGTCATCTTGGGAGAGAACAATATTATTATTTGCTTACC
HRIPAW126332ESTiNA1Nicotiana HR lesion-inducing ORF600SNPT/67/F
G/68/F
C/67/F
A/68/F
GGAAAAATTTATCCTCCAAATTGGGGGTAAAAAATAGCAGTGCACCAAAAAGTGCTG
HYPTE116AI737489ESTeNA4Unknown proteinBsrICAPS250 + 120370AACACAGAGGTAGCGTTTGGTTTATTCGGGTCAAGATCTCGTTCAA
HYPTE3AI974791ESTiNA4Hypothetical protein350SNPC/83/R
A/174/R
T/83/R
G/174/R
TCGTCTCATGGTGGAATCGTGATGGTTTCCTCCTTTAAACAAGCAAATTGGA
ISOFRAW125903ESTiAC137669.45Isoflavone reductase370SNPA/152/RT/152/RGAAGGAGTTCCTTACACTTACCTTTGTTGTTCCTCTGAAACATAAGTTTTCTCAAGA
JUNBPAW208151ESTiAC140026.63JUN kinase activation domain binding protein1150SNPC/49/FT/49/FTCTTCGTCATCATCTTCGGCGATAGCACAGGATGTGAATGATACCATCCCACGACA
KCoATAI974864ESTiNA13-Ketoacyl-CoA thiolaseEarICAPS400130 + 270TGCTACTGCGGGTGGTAGATTTACTCCAGCACCATCACTCACCT
LB1X57732GSNA5LeghemoglobinVspICAPS210170 + 40TTTTAAAGAATATAATGGCTTGTGGAGGGGAGCGAAAATGTTACCTAAAATTAAG
MAAPAI974800ESTiNA8Membrane alanylaminopeptidase990SNPT/196/F
T/205/F
A/196/F
C/205/F
TACCTAAGACTGCACATGCTATGTATCATCACCAACACGCTTTACAGTGCGGCT
MDH2AI974363ESTiAC122171.13 AC122161.111Malate dehydrogenaseDraICAPS70 + 100 + 108070 + 1180CTTCCATTTTCGATTCCTTTCATTGCATGCCTCGACAACATCAGT
MPPAA660658ESTiNA4Mitochondrial processing peptidaseBstBICAPS110 + 330440TCCCCGAAACAATCCTCATCTGGCAAATGTGTAGCCCCAAAAGTTA
MRSAA660381ESTiAC142222.7 AC144806.68Methionyl-tRNA synthetaseDdeICAPS210 + 856 + 55210 + 720 + 136 + 55GTCTGTGGTGGGATCATGGAGTTTTTGACCGGTTCCAAGTAGAGTAG
Ms/L27AW574258ESTiNA6Translationally controlled tumor protein410SNPT/56/FA/56/FATGTTGGTTTACCAGGATCTCCTTAATCATCATGCATGCTCTCACCAACA
Ms/L83AW584613ESTiNA7Aldo/ketoreductase family, Ms AJ4100921000SNPC/177/F
A/368/F
C/441/F
T/177/F
G/368/F
T/441/F
ATCCCCGCTTCCAAGCTGAGAACTAAAGGGATTTATACTTCAGGTTGAGA
Ms/U131AJ388687ESTiNA4Hypothetical protein, Ms AJ410096410SNPC/177/R
G/192/R
T/195/R
C/245/R
A/177/R
A/192/R
C/195/R
T/245/R
ATGCTATTGGGACTCAACACTCTGAGGAATTGCACTATACAGATGATAGGA
Ms/U141AW587077ESTiNA8Hypothetical protein, Ms AJ410097750SNPA/152/F
C/284/F
G/293/F
C/331/F
G/152/F
T/284/F
T/293/F
G/331/F
TTGATCAGCCACAGAAATATAAACCAGCCTCCCACAAAGTAACAAGTTTC
Ms/U336X60386GSAC135796.118Phytohemagglutinin, Ms AJ410117560SNPC/86/R
A/242/R
C/266/R
A/517/R
T/86/R
C/242/R
G/266/R
G/517/R
AGACGTGGCTAACTTCGAAACACTGAGCTTGAAACATTAGCATTGTTGTTA
Ms/U515ESTi33-PGA dehydrogenase, Ms AJ41-0128850SNPC/155/F
T/439/F
G/155/F
C/439/F
GTTAAGGGAACCATGACAACCACACATTCATTGTCATACCAAGCAACCA
MtEILlAQ841199BESTNA3Ethylene insensitiveEcoRICAPS310255 + 55GACATGTATC GGATTCTCACGAGCCACCTGCGAGGTATTCAAACTGTAA
MtEIL2BH153075BESTAC124972.185Ethylene insensitiveFOKICAPS160 + 145305GGAGCATCCATAGCCACTGTTGTATCTTTTATTTCGGTATTCATCTCCA
MTU 04AA660721ESTiNA5Hypothetica lproteinNsiICAPS310 + 8551165ATGGGAAGAGGATTGCTGTGATAAAGCGAACATTTTTGGCATCTAC
MTU07AI737610ESTeNA4Unknown proteinHinfIdCAPS27 + 153180CAGACACCCAAAGAATTACCAGAAGATGACCAGAGCCTAATACTATTTATGACT
MTU 10AI974637ESTeNA8Unknown proteinNALength200250CATCAATTTGTCAGTACTTCGGTCAGTGGGTTCAAGAAGTGGAAGTAAATAAT
NAMAI974744ESTeNA6NAM (no apical meristem)-like proteinMseICAPS130 + 7 + 120 + 33 + 96130 + 7 +153 + 96ATTCAGTGGCTCGATTGGTTCTATAACCTAAGTACACCATGTAACTAATTTTC
NCASAA660915ESTiAC 139 709.81Neuronal calciumsensor 1AciICAPS44080 + 360TTCCCAAGCCCAAATCCTAATCATCACCAGGCCATCATCATAAGT
NPACAI737554ESTiNA3Putative nascent poly-peptide-associated proteinSspICAPS340 + 130 + 270 + 500470 + 270 + 500TGGCTCCAGGTCCAGTTATTGATCGGCTCTTCTTCTCGCTTCT
NRT2AW225622ESTeNA4Putative high-affinity nitrate transporter360SNPT/116/F
C/248/F
A/116/F
A/248/F
GGAAGCTCCATGCATGGAGTAATTGCACCCATTGCAAGCCTTGAGA
NTRBIAI974835ESTiAC119410.48Retino-blastoma-related proteinEcoRVCAPS428 + 132560CACGACTCTGCACGCTTTGTTAACCCTTGTTGCGAGTCATTTG
NUM1AA660969ESTiNA4Homolog of mammalian nucleolinTaqICAPS48 + 29 + 24348 + 272GATGCTGCTCCTGTTGTTGTTTCAAAACAAAGTAAAAACAATATCTTTAAAAATC
OXGAW126122ESTiNA6Oxygenase720SNPG/311/F
C/367/F
T/411/F
A/311/F
T/367/F
C/411/F
AGGTGTAGCAAGATATAACCAATTCAGGATTTGGTGGTGCATCCCAAACAGAGAAAG
PAEAA660802ESTiNA8Pectinacetyl-esterase precursorFokICAPS610 + 190340 + 270 + 190CTAAAAGCAGCAGAAGGGGTTACGATCCGGTCAAGGCAAGTAGTT
PCTAI974454ESTeAC131248.54Cholinephosphate cytidylyl-transferaseRsaICAPS240150 + 90TTGGCAAAAACGATAAACCTGTCACGGCACATCTGGAATAACTT
PESR1AA660526ESTeAC122166.147Pectin esteraseAciICAPS237176 + 61CATCTGAACAAACCCATCTCCAGCTGTTAATTCGGCGTTTGA
PFKAA660630ESTiNA2Ppi-dependent phosphofructokinase β-subunitSspICAPS50080 + 420TCCCACTGCAAATCATGTCAAAACACACAAGTGGATATTGATGGTTAGACTAC
PGDHAW126358ESTiNA7Phospho-gluconate dehydrogenase490SNPA/189/FC/189/FGAGTTGAAGCTGCAAAGGTCTTTAAATCATGTATGAGCACCGAAGTAGTCTCGTTGA
PGKIAA660202ESTiNA2Phosphoglycerate kinaseDrdICAPS550210 + 340GATGACTGTATTGGCGAGGAAGTGTTCGACACGGCTCCAACTA
PNDKN1AW127113ESTiNA8Nucleoside diphosphate kinase I>1000SNPG/337/FA/337/FGGCCGAACAAACTTTCATCATGATCACCAGGCTCGGATTGAGCAGGGTTTGT
PPDKAI737496ESTeNA8Pyruvate phosphate dikinaseNALength250230CAGCAGGGCATAGTCAAATAAGGAATCCACATAAGTTCACCGTAAGAGT
PPGMAA660893ESTiAC124215.137Phospho-glycerate mutaseBbvICAPS165 + 210375AAAGAAAGATGGGAAGCACTGATTACCAAGCGCGTTATGACCAA
ppPFAI974685ESTeNA1Ppi-dependent phosphofructokinase subBstNICAPS13030 + 100TCTCGCCACCAACAACAACTACAAAAATTGTTCATGAACACTCACTTGAAGCCA
PROFAW126318ESTeAC122730.156Profucosidase320SNPT/197/FC/197/FAGAAGTCAAAAATGGTCTACCAGTGACAAATCTTCCAATATCCAAACAAGTAGGA
PRTSAI737609ESTeAC141863.6320S proteosome β-subunitBsaJICAPS200 + 50250CATAGCTACTTGATCTGAAAACTTGACATGGTGAACTTCACTACCATTACAACC
PTSBAW127108ESTiNA5Proteasome β-subunit370SNPA/80/FT/80/FACTAAACAACACGCTAATTGGTCTCCAATGCCTAGCAGACAAAACCTTCTGCA
QORlikBEST4Mt-apy2RsaICAPS119 + 290409GATGGTCTGGCAACTGTAGGGAGGACTTTTCTTAG
RBBPAA660276ESTiAC121243.102WD-40 repeat protein MSI4BglIICAPS220 + 8601080CAAGAGGACGCAAACCTAAACCCACAATTCGCAATCACCAAAGTAT
REPAA660953ESTiNA8Poly(A)+ RNA export proteinHaeIIICAPS30 + 69030 + 105 + 585CTCCATTTCCCGTTCGTTCGCACCGGTTGCCCTCCAGAC
riplU16727GSNA5Peroxidase precursorSspICAPS81 + 320 + 37 + 134 + 5981 + 320 + 171 + 53GCAATGCGTTGCTAGGGATTAATGATGTGACCAGTTTATAAAGAGTAACACACATCTCACC
RL13AA661027ESTeNA2Ribosomal protein LI 3MseICAPS35 + 10 + 30 + 65 + 4035 + 105 + 40GCCAAGCAGGTATCTATTCTTCATCTCGGTACACAACATAACCCTAAAATCA
RL3AI974458ESTiNA1Ribosomal protein L3PacICAPS250 + 100 + 230250 + 60 + 40 + 230GACACGGTTCTTTGGGATTTCTCCCTGGCTTTTCGACTTCTCTGAC
RLPOAI974311ESTiNA360S acidic ribosomal protein POBspHICAPS320 + 7401060TCTTGGCCCTTTAATTTCCTCTCAACCTTGTATTTAGCAACTTCTTCACTG
RNAHAI974503ESTiAC123899.137ATP-dependent RNA helicasesApaICAPS940280 + 660GCTTCCACCAGCTGATACACGTTAGCCCTAGCAAGAATGTCACTG
SAMSAI974327ESTiNA2S-adenosyl-methionine synthase 2BstBICAPS1050525 + 525CATAGCAAAGCGGGTTCAATCTGTCAGCATCAAGACCAACATCATC
SATAW126397ESTiNA1Sulfa teadenylyl transferase810SNP::/260/RCA/260/RGTATCATGATGGACTTGATCATTTTCGTCAGCCTTTGCATGCCACTGCACCTCA
SCPAA660552ESTeNA1Serine carboxy-peptidase IIHincIIdCAPS10030 + 70CACCAGCAGGAGAATCAAGGAACTCGATTCGTACCCAATTTGTTTTTCAATTGTT
SDP1AI974323ESTiNA8Seed protein precursorSspICAPS76 + 829 + 6276 + 726 + 103 + 62TGGCTCTAAATCAGGGGAAGAATATGTGACGGTTGAATATCTGAATGTTT
SQEXAA660711ESTiNA8Squalene mono-oxygenaseEcoRVCAPS810 + 260190 + 620 + 260TGCCGCTATAAAAAGTAAACAAAGAACAATTCACCCACAATTCTATCAGG
SUSYAW126351ESTiAC135798.188Sucrose synthase500SNPT/103/F
C/136/F
C/103/F
T/136/F
TCGCAATGAACCACACAGATTTCAGTCCAACCTTGCCATGGTGAAGATA
TBB2AW191276ESTiAC144474.14Tubulin β-2 chain450SNPC/147/RT/147/RTGTGGGATTCCAAGAACATGATGTGTTCATACTCATCCTCCTCTGCAGTA
TCMOAW127521ESTiAC141923.75Trans-cinnamate4-mono-oxygenase880SNPA/130/R
A/162/R
C/220/R, etc.
G/130/R
T/162/R
A/220/R, etc.
GTCTACGGCGAACATTGGCGTAAAATGCCAATTGCAGCAACATTGATGTTCTCAACA
TE001AI737538ESTiAC130963.136CCCH-type zinc-finger proteinXmnICAPS500 + 5001000CGGCGCCGGAGATTACACTGAATCACAAACCCACCCAACATCTG
TE011AI737478ESTiNA4SCARECROW gene regulatorAclICAPS1140 + 4101140 + 220 + 190GGAGAGAAACCGGACTGAAGAAACACAAGAAGAAGCCCTAGTCCTCCATT
TE013AI737484ESTiAC130963.136Same asTEOOlXmnICAPS320 + 500820TCCGCATGTACGAGTTCAAGATAAGAAATCACAAACCCACCCAACATC
TE016AI737494ESTiAC138016.84Cyanogenic β-glucosidaseSalICAPS1300400 + 900TCCCCAGGCCTTACAAGATGATTATAAACACTCCCACGTCGCACTAAG
TE019AI737500ESTiAC137666.75Unknown proteinAflIICAPS150 + 9501100GCATGTGACCGATGAGGAAACCTTTTAGAATCAACAATGCAACCAGAAG
TGDHAA660742ESTiNA4dTDP-glucose 4-6-dehydrataseMnlICAPS34060 + 280CGGTGGCTTCATCGGTTCTGACGTGTATTGTAATCAGCAGGAGTA
TGFRIPAW225617ESTeAC124957.122Putative TGF-β receptor interacting protein320SNPT/254/FC/254/FATTCTGATGAAAGGCCACGAGAGGCCACAAGCTTATCACCAACAGAGAAATCGA
tRALSAW126282ESTiAC125476.94Cytosolic tRNA-Ala synthetase330SNPA/52/RG/52/RGGTCTGCGAGCTGTTTTTGGAGAAGGCAATTCCCTCCTCAGCTAAAAGTG
TRPTAA660362ESTeAC122170.163Triosephos-phate translocatorDdeICAPS29060 + 230AACCACAATCTTTTCTCCCATCTTAACATTCAAAGCCCACCAAGTT
TUPAA660945ESTiAC136288.121Translationally controlled tumor proteinBclICAPS620230 + 390GAATGGGATGCTATGGGAAGTGTGGATCAGTGGCACCATCTTTAT
UDPGDAI974577ESTiAC119411.37UDP-glucose 6-dehydrogenaseMnlICAPS1350230 + 1120CAAAAGCGTTTCATCACTCATCTCTATCGTCAAGGCCAGGTTCATAG
UNK16AI974672ESTeNA4Hypothetical proteinFspICAPS330150 + 180CCTTCCAATATCCCTCCCACATGAAGAAAATGATGAAAAGCCAAAAG
UNK21AI974840ESTiNA7Hypothetical proteinEarICAPS90 + 830920TCGCCTCCATGTCCACCTCCGGCCTTGCTAAATCAGTCAG
UNK27AW225606ESTeNA4dTDP-glucose 4-6-dehydratase320SNPT/47/F
C/80/F:/220/F
A/259/F
C/47/F
T/80/F
T/220/F
C/259/F
GGCTTCATCGGTTCTCATCTCTGCGATGTAATCAGCAGGAGTACAAATTGCAGCCA
UNK29AW171637ESTiNA1Unknown protein>1000SNPC/328/RT/328/RCTAACTAATTCTGATCTTCGAGAAGAGGCTGGAGTGATTATATTTGTCGGCTGAAATA
UNK3AI974271ESTiNA4VAMP-associated proteinMboIICAPS47080 + 390CACCGGAAATTCAACAGCAACGACCTAGGCAACACAACTCCATTA
UNK7AI974400ESTiNA5Putative proteinXhoICAPS1250 + 1701420AAAAAGCAGCAAGAGAAATGTCAATGAGAATCTTTCTCCATCGTATCTTACTT
VBP1AI974413ESTiAC122169.127TGA-type basic leucine zipper proteinDrdICAPS950110 + 840CTGGAGAGCAGACCCATTCAATGCGAAAGC CTC CAATCCAC
WPK4AA660716ESTeNA5Serine/threonine kinaseSpeIdCAPS220190 + 30AGCAACTACAAATAGTTATGCAAAAGACTATGCTGTATGAGCTGCACTTGTCTG
zwilikBH153068BESTNA1Zwille-like geneXmnICAPS475350 + 125ATTTGAGTGTACCCATTGAGATTTTTGAAGATTTATTTGTAGAGTA

ESTe, exon-derived markers; ESTi, exon-derived/intron-spanning markers; BEST, BAC end-sequence-tagged markers. Markers derived based on genetic markers in other legume species are indicated by the prefixes Gm (G. max), Ms (M. sativa), and Vr (V. radiata) under the “Putative function or probe” column. Where possible, GenBank accession numbers are also given for the corresponding legume homolog. NA, not available. In the case of SNP markers, the nomenclature indicates the nature of the base change and its position in the amplicon relative to the forward or reverse primer. Thus, “A/259/F” refers to adenine at position 259 relative to the forward primer.