TABLE 3

Repeat families derived from X-enriched 9mers

No.NameNo. of
nonamer members
in Table 2
Approximate
true repeat
length
Approximate true repeat unit
Clustered repeats
1Left end251, 39, 49, 21Four related repeat families, see belowa
2CeRep276226See belowb
3C07D82340ccggcgcccatttaagggtaaggaatcgctctaagcgaaa
4Right centerc733aaaaccgctccaaaaccgttccaataccgctcc
5Short clusters432cgacctaggtcgctaggtcgcaggtcgcaaag
6Right end345gaagtgctttctgtcgtactcgaagcagtgctggtggatggagtc
Unclustered repeats
1Unclustered #1214aggcagtaacggtt
2Unclustered #2210aggtcacgag
3Unclustered #3210actaccgact
4Unclustered #4311cgcactgacck
5Unclustered #519actacgtaa
6Unclustered #619ccagtcgtg
7Unclustered #719ttgcgacct
8Unclustered #819acctgcgac
  • “Approximate true repeat unit” and “approximate true repeat length” were determined by manual examination of the X chromosome sequence near the positions reported by the 9mer map. Therefore, variations of the stated consensus may be present in any particular repeat unit. CeRep27 is reported to be excluded from introns (C. elegans Sequencing Consortium 1998).

  • a Left-end repeats:

    Rpt 1 gttttggtcgctgctaatttttggtcattgctaatttttagtcagtgctaa

    Rpt 2 ggtcagtgcaacttaaattggtcagtgcaactgcaact

    Rpt 3 ggtccgtgcacatgttttttggtcagtgcacgtggtttctttttcttt

    Rpt 4 cagtgcctatgaaagattggt.

  • b C. elegans repeat family #27 consensus:

    aaatgtctttcagaaactttgtagtaaattttaagctctttctgaatatattaaaaatattccagtaggtacaagaagcttcacgtagttacagaaatagtacattttc agccctaccttttagtgcgtattttattattaaatgaaaactaccatttataagcaaaaatagatggattttcgtaattgtgaaaattcataaatctcttcaaagtaac tttttttg.

  • c There are additional repeat units that are not X enriched found just downstream of this family:

    1 agagagtaaaaaatatggtgaatcc

    2 agcggttatgg.