Originally published as Genetics Published Articles Ahead of Print on February 2, 2009.

Genetics, Vol. 181, 1347-1357, April 2009, Copyright © 2009
doi:10.1534/genetics.108.099002

GPC-1, a G Protein {gamma}-Subunit, Regulates Olfactory Adaptation in Caenorhabditis elegans

* Department of Biophysics and Biochemistry, {ddagger} Molecular Genetics Research Laboratory, Graduate School of Science, The University of Tokyo, Tokyo 113-0033, Japan and {dagger} Department of Biology, Graduate School of Science, Kyushu University, Fukuoka 812-8581, Japan

2 Corresponding address: Department of Biophysics and Biochemistry, Graduate School of Science, The University of Tokyo, Science Building 7, Room 603, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan.
E-mail: iino{at}biochem.s.u-tokyo.ac.jp

Manuscript received November 22, 2008. Accepted for publication January 24, 2009.

ABSTRACT

Caenorhabditis elegans genome carries two G{gamma} genes, gpc-1 and gpc-2, and two Gβ genes, gpb-1 and gpb-2. Of these, gpc-2 and gpb-1 are expressed ubiquitously and are essential for viability. Through a genetic screen, we identified gpc-1 as essential for olfactory adaptation. While wild-type animals show decreased chemotaxis to the odorant benzaldehyde after a short preexposure to the odorant, gpc-1 mutants are still attracted to the odorant after the same preexposure. Cell-specific rescue experiments show that gpc-1 acts in the AWC olfactory neurons. Coexpression of GPC-1 and GPB-1, but not GPB-2, caused enhanced adaptation, indicating that GPC-1 may act with GPB-1. On the other hand, knock down of gpc-2 by cell-targeted RNAi caused reduced chemotaxis to the odorant in unadapted animals, indicating that GPC-2 mainly act for olfactory sensation and the two G{gamma}'s have differential functions. Nonetheless, overexpression of gpc-2 in AWC neurons rescued the adaptation defects of gpc-1 mutants, suggesting partially overlapping functions of the two G{gamma}'s. We further tested genetic interaction of gpc-1 with several other genes involved in olfactory adaptation. Our analyses place goa-1 Go{alpha} and let-60 Ras in parallel to gpc-1. In contrast, a gain-of-function mutation in egl-30 Gq{alpha} was epistatic to gpc-1, suggesting the possibility that gpc-1 G{gamma} may act upstream of egl-30 Gq{alpha}.


ANIMALS sense a variety of stimuli from the environment and change their response on the basis of prior experience to eventually maximize the chance of survival. One of the evolutionarily ancient types of plasticity of sensory responses is olfactory adaptation, in which the sensitivity of animals to volatile chemicals is decreased after prolonged exposure to the compound. Studies in vertebrate olfactory neurons, and on molecules that act therein, have revealed importance of several pathways in olfactory adaptation; calcium/calmodulin regulation of cyclic nucleotide-gated channel, calcium/calmodulin-dependent protein kinase II (CaMKII)-mediated regulation of adenylyl cyclase, and possibly the CO/cGMP pathway (ZUFALL and LEINDERS-ZUFALL 2000).

The soil nematode Caenorhabditis elegans also recognizes numbers of volatile chemicals or odorants (BARGMANN et al. 1993). These compounds may be important cues for food, mating partners, or predators. Olfactory adaptation in this organism is usually assessed on the basis of its behavior, as a decrease of chemotaxis to odorants after continuous exposure to the same odorant for 0.5–1 hr (COLBERT and BARGMANN 1995). Chemoattractive behavior is mediated mainly by two pairs of amphid sensory neurons (olfactory neurons), AWA and AWC (BARGMANN et al. 1993). In these neurons, odorants are thought to be received by olfactory receptors that are seven-transmembrane G protein-coupled receptors as is the case in mammals (TROEMEL et al. 1995). G protein {alpha}-subunits ODR-3, along with GPA-3, are required for odor sensing in both AWA and AWC (LANS et al. 2004). In addition, guanylyl cyclase ODR-1 (L'ETOILE and BARGMANN 2000) and cyclic nucleotide-activated channel TAX-2/TAX-4 (COBURN and BARGMANN 1996) are essential in AWC neurons, while chemosensation in AWA neurons depends on TRPV channels (COLBERT et al. 1997). Several mutants defective in olfactory adaptation have been reported, including OSM-9 TRPV channel, which is required for adaptation in AWC neurons (COLBERT et al. 1997), EGL-4 cGMP-dependent protein kinase (L'ETOILE et al. 2002), GOA-1 Go{alpha} (MATSUKI et al. 2006), and TBX-2/TBX-3 transcription factors (MIYAHARA et al. 2004). Overexpression of guanylyl cyclase ODR-1 (L'ETOILE and BARGMANN 2000) and activating mutation in EGL-30 Gq{alpha} also cause adaptation defect (MATSUKI et al. 2006). The Ras-MAPK pathway, which is required for efficient sensing of odorants (HIROTSU et al. 2000), was also shown to be important for olfactory adaptation in a modified adaptation assay in which olfactory adaptation is observed as early as after 5 min of preexposure to odorants (HIROTSU and IINO 2005). On the basis of these observations, various molecular mechanisms have been suggested for olfactory adaptation, but further studies are required for full understanding of the interrelationships of the molecules involved. For example, although multiple types of G protein {alpha}-subunits are involved in odor sensing and adaptation, roles of β{gamma} subunits are currently unexplored.

C. elegans also shows other types of plasticity in its response to sensory stimuli. Of particular interest is salt chemotaxis plasticity, another well-described behavioral plasticity paradigm in C. elegans, which shows similar characteristics to olfactory adaptation. This behavioral modification is regulated by the availability of food (SAEKI et al. 2001), which is also the case for olfactory adaptation (COLBERT and BARGMANN 1997; NUTTLEY et al. 2002). Furthermore, several common genes are known to regulate both olfactory adaptation and salt chemotaxis plasticity. For example, mutants of goa-1 Go{alpha} (MATSUKI et al. 2006), egl-30 Gq{alpha} (MATSUKI et al. 2006; TOMIOKA et al. 2006), arr-1 β-arrestin (PALMITESSA et al. 2005; HUKEMA et al. 2006), egl-4 cGMP-dependent protein kinase (L'ETOILE et al. 2002; HUKEMA et al. 2006), and osm-9 TRPV channel (COLBERT et al. 1997; JANSEN et al. 2002) are all defective in salt chemotaxis plasticity as well as olfactory adaptation.

C. elegans possesses only two G protein {gamma}-subunit (G{gamma}) genes, gpc-1 and gpc-2. Previous observations using reporter constructs revealed that gpc-1 is expressed only in sensory neurons, whereas gpc-2 was reported to be expressed in all neurons and muscles (JANSEN et al. 2002). In agreement with the sensory neuron-specific expression of gpc-1, the mutant animals of gpc-1 display defects in salt chemotaxis plasticity and plasticity of the response to Cu2+ (JANSEN et al. 2002; HILLIARD et al. 2005).

In a genetic screening for olfactory adaptation mutants, we found that gpc-1 mutants also show olfactory adaptation defects. The mutant animals of gpc-1 show strong olfactory adaptation defect especially when the preexposure time is short. In olfactory adaptation, gpc-1 acts only in AWC sensory neurons, which sense the odorant benzaldehyde used in the experiments. Furthermore, our data suggest that the existence of functional Gβ{gamma} dimers of GPB-1 and GPC-1 are important for olfactory adaptation and the Gβ{gamma} dimers of GPB-1 and GPC-2 mainly act for olfactory sensation.


MATERIALS AND METHODS

Strains and culture conditions:

C. elegans were cultured at 20° under standard conditions (BRENNER 1974), except that the Escherichia coli strain NA22 was used as food. Bristol N2 was used as the wild type. The following mutants were used: egl-30(js126) I, goa-1(n1134) I, che-1(p674) I, let-60(n1046) IV, arr-1(ok401) X, gpc-1(pk298) X, and gpc-1(pe372) X.

Genetic screens for olfactory adaptation mutants:

Mutagenesis was performed as described (BRENNER 1974). Roughly 18,000 F1 animals were divided into 48 independent groups and cultured separately. F2 animals were tested for olfactory adaptation defects; animals that were attracted to 1:400 dilution of benzaldehyde after preexposure to 100 nl/ml of benzaldehyde for 5 min were isolated. These mutant candidates were cultured and the progeny were further screened with the same manipulation for an additional 5 generations to concentrate mutants. Finally, single worms were picked from each group and the progeny were tested for adaptation defects.

Mapping and cloning of pe372:

Mutants with visible markers, MT464 [unc-5(e53) IV; dpy-11(e224) V; lon-2(e678) X] and MT465 [dpy-5(e61) I; bli-2(e768) II; unc-32(e189) III], were employed to allocate pe372 to linkage group X. The position responsible for adaptation defects was finely mapped using single nucleotide polymorphisms (SNPs) between N2 and the Hawaiian strain CB4856 (WICKS et al. 2001).

Chemotaxis and adaptation assays:

Chemotaxis assays to benzaldehyde were performed as described (MATSUKI et al. 2006). Adaptation assays were performed as previously described (HIROTSU and IINO 2005) with modification. Briefly, cultured worms were washed three times with basal buffer (5 mM potassium phosphate, 1 mM CaCl2, 1 mM MgSO4, and 0.5 g/liter gelatin). Animals were then incubated with 200 µl of basal buffer with (preexposed) or without (mock preexposed) 100 nl/ml of benzaldehyde. Unless otherwise noted, preexposure was 5 min. After preexposure, the animals were washed once with basal buffer and placed at the center of the assay plates. On the plates of adaptation assays, 1 µl each of diluted benzaldehyde was spotted on two points separated by 2.5 cm at one end of the plates. One M NaN3 (0.5 µl each) was spotted on two points with the same spacing of 2.5 cm at both ends of the plates (supplemental Figure 1A). The dilution of benzaldehyde in ethanol was 1:400 dilution for adaptation assays. Fifteen minutes after placing the animals at the center of the assay plates, the animals were counted by dividing the plates at the center into two regions, A and B, while the animals that remained within 0.5 cm from the center were not counted.

The chemotaxis index for adaptation assays is (A – B)/(A + B) where A was the number of animals on the odorant-spotted side of the plate and B was the number of the animals on the opposite side.


RESULTS

A genetic screen for mutants with abnormality in olfactory adaptation:

To improve the understanding of the mechanisms of olfactory adaptation, we performed a genetic screen to obtain adaptation-defective mutants. Rather than using the conventional adaptation assays, we employed a modified assay format we have previously reported (HIROTSU and IINO 2005). In this assay, olfactory adaptation is observed after a short odorant preexposure. Using this paradigm, animals that do not show reduction of chemotaxis to benzaldehyde after 5 min of preexposure to the odorant were collected. We screened 36,000 EMS mutagenized haploid genomes and isolated 26 independent mutants.

Several mutants showed severe defects in adaptation after both 5 min and 60 min of preexposure to benzaldehyde, while others exhibited no or minor defects after 60 min of preexposure. JN372 was one of the mutants showing the most severe defects after 5 min of preexposure with minimal defects after 60 min (Figure 1A, pe372). Adaptation defects can be caused by reduced sensitivity to odorants. However, chemotaxis assays using different concentrations of benzaldehyde revealed that JN372 animals have no defect in the sensitivity to the chemical (Figure 1B). In time-course experiments, wild-type animals quickly adapt after 5 min of odorant preexposure and the chemotaxis index further decreases by longer preexposure of up to 60 min, at which time the animals show strong avoidance of benzaldehyde, similar to the previous report (NUTTLEY et al. 2001). JN372 animals showed almost no adaptation after 5 min of preexposure, while the adaptation defect was small after 60 min of preexposure (Figure 1C). Therefore JN372 appears to be a mutant that adapts slowly and/or weakly to the odorant.


Figure 1
View larger version (12K):
In this window
In a new window
Download PPT slide
 
FIGURE 1.—

Properties of olfactory adaptation and chemotaxis of wild-type animals and gpc-1 mutant animals. (A) Olfactory adaptation of wild-type, gpc-1(pe372), and gpc-1(pk298) animals. Worms were treated with 5 min of preexposure with basal buffer (open bars) or benzaldehyde (100 nl/ml; solid bars) and assayed for chemotaxis. Both pe372 and pk298 mutants are defective in olfactory adaptation. (B) Chemotaxis of untreated wild-type and pe372 animals to different concentrations of benzaldehyde. pe372 animals respond normally to a wide range of concentrations. (C) Olfactory adaptation assays with various durations of preexposure. Basal buffer (dotted lines), and benzaldehyde (100 nl/ml; solid lines). pe372 animals adapt to benzaldehyde weakly compared to wild-type animals. **P < 0.001; *P < 0.01.

 

A G protein {gamma}-subunit, GPC-1, is required for olfactory adaptation:

We mapped the mutation responsible for the adaptation defect of JN372, pe372, using the linkage with the visible marker genes and SNPs between the Bristol N2 strain and the Hawaiian CB4856 strain (see MATERIALS AND METHODS for details). pe372 was linked to lon-2 on linkage group X. Fine mapping using SNPs revealed that pe372 resides between two SNPs, uCE6-1303 and uCE6-1307.

There were only three predicted genes in the mapped region (Figure 2A). Three lines of experimental evidence identified pe372 as an allele of gpc-1. First, the mutant of gpc-1(pk298) showed olfactory adaptation defect comparable to pe372 (Figure 1A). Second, introduction of a cDNA for gpc-1 driven by the 5.2-kb authentic promoter, Pgpc-1::gpc-1, rescued the olfactory adaptation defect of pe372 mutant animals (Figure 3A). Finally, we found 1758 bp of deletion in gpc-1 in the pe372 mutant genome (Figure 2B). Because the deletion covers the half of the gene including the start codon, pe372 is considered to be a null mutation of the gpc-1 gene. Thus, we concluded that the deletion in gpc-1 caused the adaptation defects in pe372 animals.


Figure 2
View larger version (19K):
In this window
In a new window
Download PPT slide
 
FIGURE 2.—

Positional cloning of pe372. (A) Genetic and physical maps of chromosome X. pe372 was mapped to an ~50-kb interval between two SNPs, uCE6-1303 and uCE6-1307. Only three genes, bcat-1, gpc-1, and pqn-18, were predicted within the mapped region. Three cosmids in this region, T14G8, K02A4, and C34E7 are also displayed at the bottom. (B) The gene model of gpc-1 and the lesions of gpc-1 mutants. pe372 is a 1758-bp deletion that lacks the initiation codon and upstream sequence of the predicted ORF. The flanking sequences of the deletion are "tgatgaaaagaaaacataaa" and "gtggcaagcactaaactgta." The deletion of 720 bp in gpc-1(pk298) is also displayed.

 

Figure 3
View larger version (45K):
In this window
In a new window
Download PPT slide
 
FIGURE 3.—

gpc-1 acts in AWC sensory neurons. (A–C) gpc-1 is required in AWC sensory neurons for olfactory adaptation. gpc-1 cDNA was fused to various promoters that drive cell-specific expression, and resulting constructs were introduced into gpc-1(pe372) (A and C) or che-1(p674); gpc-1(pe372) animals (B), as indicated. **P < 0.001; *P < 0.01. (D–F) Fluorescent images of the head region of an adult animal (depicted in the DIC image in D) transformed with Podr-3::mRFP and Pgpc-1::venus. Podr-3::mRFP is expressed in AWC and AWB (E). Pgpc-1::venus is expressed in AWC, ASE, and RIB in addition to the previously reported neurons, ADL, ASH, ASI, and AWB (F).

 
gpc-1 encodes one of the two G protein {gamma}-subunits (G{gamma}) in C. elegans (JANSEN et al. 1999). It has been reported that gpc-1 is involved in salt chemotaxis plasticity (JANSEN et al. 2002), while no olfactory adaptation defect was observed in gpc-1 mutants (JANSEN et al. 2002; LAW et al. 2004). Thus, this is the first report that C. elegans gpc-1 is involved in olfactory adaptation. We surmise that our assay system for olfactory adaptation was somewhat more sensitive than that of conventional adaptation assays and therefore we could detect the adaptation defect of the gpc-1 mutants (see DISCUSSION).

GPC-1 acts in AWC sensory neurons for olfactory adaptation:

Previous studies suggested that olfactory adaptation depends on the functions of both sensory neurons and interneurons. To determine the cells in which gpc-1 acts for adaptation, we expressed the gpc-1 cDNA using cell-specific promoters in gpc-1(pe372) mutants and the transformants were tested for olfactory adaptation behavior (Figure 3A). The olfactory adaptation defect of gpc-1(pe372) mutants was rescued when gpc-1 was expressed by the promoters of gcy-10, odr-3, gpa-13, and ceh-36. The expression patterns of these promoters overlap only in AWC neurons. On the other hand, expression of gpc-1 in cells other than AWC neurons by the promoters of gpa-4, sro-1, ttx-3, str-1, and gpa-11 did not rescue the defect.

To test more strictly whether the expression of gpc-1 only in AWC neurons is sufficient for olfactory adaptation, we repeated the cell-specific rescue experiment by the ceh-36 promoter, but in the che-1(p674); gpc-1(pe372) background (Figure 3B). In addition to AWC, the ceh-36 promoter is expressed also in the salt-sensing ASE neurons in the wild type, but it is expressed only in AWC neurons in the che-1 mutant in which ASE neurons fail to acquire its identity (UCHIDA et al. 2003; KOGA and OHSHIMA 2004). che-1 animals showed normal olfactory adaptation phenotype and che-1; gpc-1 animals showed an olfactory adaptation defect. The expression of gpc-1 cDNA by the che-36 promoter rescued the olfactory adaptation defect of che-1; gpc-1 animals. These results indicate that the function of gpc-1 only in AWC neurons is sufficient for olfactory adaptation.

It has been previously reported that gpc-1 is expressed specifically in sensory neurons ADL, ASH, ASJ, AFD, ASI, AWB, and PHB (JANSEN et al. 2002). Because the olfactory neurons AWC were not included in this set, we reexamined the expression pattern of a Pgpc-1::venus transcriptional reporter fusion in wild-type background. At the first larval (L1) stage, reporter expression was mainly observed in the cells previously reported. At the adult stage, expression in AWC, ASE, and RIB was also observed (Figure 3, D–F). The reporter expression in AWC was confirmed by coexpression with Podr-3::mRFP, which drives the expression of mRFP in AWC and several other amphid neurons (Figure 3, E and F). AWC neurons are known as chemosensory neurons that receive attractive odor including benzaldehyde (BARGMANN et al. 1993), which we used in the experiments. These data thus indicates that gpc-1 acts only in the odor-sensing neurons for olfactory adaptation.

The seven-transmembrane olfactory receptor str-2 is expressed in either the right or left member of the AWC neuron pair in a random manner, and the str-2-expressing neuron is defined as AWCON and the other as AWCOFF (TROEMEL et al. 1999). The two AWC neurons are functionally distinct from each other. For example, AWCON detects the odorant butanone while AWCOFF detects the odorant 2, 3-pentanedione. In contrast, benzaldehyde is detected by both AWC neurons (WES and BARGMANN 2001). To determine whether the expression of gpc-1 in either type of AWC neuron is sufficient for olfactory adaptation, we expressed gpc-1 in AWCON, AWCOFF, or both of the AWC neurons (Figure 3C). The defect of gpc-1 mutants was rescued only when gpc-1 is expressed in both of the AWC neurons. These results indicate that GPC-1 is required in both of the AWC neurons for proper adaptation. When gpc-1 is expressed in only one AWC neuron, the other neuron probably cannot adapt to the odorant, and the olfactory adaptation defect is revealed. This interpretation is consistent with the fact that animals with either of the AWC neurons ablated still show normal chemotaxis to benzaldehyde (WES and BARGMANN 2001).

GPC-1 acts with GPB-1 in olfactory adaptation:

G{gamma} ordinarily acts with Gβ in a complex. In C. elegans, two Gβ-encoding genes, gpb-1 and gpb-2, are predicted on its genome (JANSEN et al. 1999). On the basis of the primary sequence, GPB-2 is categorized to the Gβ5 subtype, which can function with either G{gamma} or regulator of G protein signaling (RGS). In contrast, GPB-1 belongs to the Gβ1–4 subtype, which requires coupling with G{gamma} for their functions.

To determine which Gβ acts with GPC-1, we co-overexpressed gpc-1 with gpb-1 or gpb-2 in AWC and observed the effect on chemotaxis. When gpc-1 was co-overexpressed with gpb-1 using the odr-3 promoter, chemotaxis index was decreased significantly compared to the control, both in animals mock preexposed and those preexposed to the odorant (Figure 4A). This result indicates that gpc-1, along with gpb-1, has the ability to reduce the chemotaxis toward the odorant. Assuming that the effect of overexpression is opposite to that of the loss of gpc-1, which causes an adaptation defect, we call it enhanced adaptation. Reduced chemotaxis index of mock-preexposed animals could be caused by enhanced adaptation of the animals to the odorant encountered during the chemotaxis assay or the odor of bacterial food during cultivation. Such enhanced adaptation was not observed by co-overexpression of gpb-2 and gpc-1. When gpc-1, gpb-1, or gpb-2 were individually expressed, there was no effect on olfactory adaptation (P > 0.01 for each line; Figure 4A). These results are consistent with the idea that Gβ{gamma} consisting of GPB-1 and GPC-1, but not GPB-2 and GPC-1, regulates olfactory adaptation and acts negatively on odorant chemotaxis. They also suggest that endogenous expression levels of Gβ and G{gamma} are precisely matched because overexpression of neither component has an effect.


Figure 4
View larger version (15K):
In this window
In a new window
Download PPT slide
 
FIGURE 4.—

GPB-1, but not GPB-2, may function with both GPC-1 and GPC-2 in olfactory adaptation. (A) The expression of gpc-1, gpb-1, or gpb-2 in AWC sensory neurons using the odr-3 promoter does not affect the olfactory adaptation of wild-type animals significantly (P > 0.01). Enhanced adaptation was observed only when gpb-1 and gpc-1 were co-overexpressed in AWC sensory neurons. (B) The expression of gpc-2 in AWC sensory neurons fully rescues the olfactory adaptation defect of gpc-1(pe372) animals. **P < 0.001.

 
The odr-3 promoter used in the overexpression experiment drives expression in AWC, AWB, AWA, ASH, and ADF (ROAYAIE et al. 1998). To determine which of these neurons are responsible for the enhanced adaptation observed by Gβ{gamma} overexpression, we used combinations of promoters for expression of gpb-1 and gpc-1. For example, when odr-3 promoter and ceh-36 promoter were used for expression of gpb-1 and gpc-1, respectively, co-overexpression can be achieved only in AWC. With this strategy, we found that the co-overexpression of gpb-1 and gpc-1 in AWC was sufficient for the enhanced adaptation, while co-overexpression in AWB or ASH had no effect (supplemental Figure 2A). Involvement of AWC for enhanced adaptation is consistent with the results of rescue experiments in which gpc-1 is required in AWC for olfactory adaptation (Figure 3, A–C).

The role of gpb-1 was also assessed by observation of loss-of-function phenotypes. Unfortunately, gpb-1 mutant animals are embryonic lethal (ZWAAL et al. 1996; GOTTA and AHRINGER 2001). Therefore we performed cell-specific RNAi by introducing transgenes that express both sense and antisense RNA of gpb-1, or other genes, by the odr-3 promoter (ESPOSITO et al. 2007). The knockdown of gpc-1 caused olfactory adaptation defect as expected, though the defect was weaker than the gpc-1 mutants (Figure 5). Knockdown of gpb-1 caused a strong adaptation defect, supporting the above model that GPB-1 and GPC-1 act together for olfactory adaptation. Knockdown of gpb-1 also caused a reduction of chemotaxis in mock-preexposed animals, which will be discussed later.


Figure 5
View larger version (13K):
In this window
In a new window
Download PPT slide
 
FIGURE 5.—

Cell-specific knockdown revealed the functional features of gpc-1, gpc-2, and gpb-1. Sense and antisense RNA of gpc-1, gpc-2, or gpb-1 were expressed by the odr-3 promoter. For gpc-2, knockdown was performed also in the gpc-1(pe372) background. The results of two lines for each RNAi construct are shown. **P < 0.001; *P < 0.01.

 

GPC-2 mainly acts for the sensation in AWC neurons and have partially overlapping function with GPC-1 in olfactory adaptation:

Of the two G{gamma} genes, knockdown of gpc-2, but not gpc-1, induces embryonic lethality caused by improper orientation of mitotic spindle during early embryogenesis (GOTTA and AHRINGER 2001). Because GPB-1 is also known to be involved in orientation of early cell division axes (ZWAAL et al. 1996), GPC-2 is considered to act with GPB-1 in this process. Although expression of gpc-2 continues postembryonically in neurons, its neuronal function is not uncovered. Because gpc-2 is reported to be expressed in all neurons and muscle cells (JANSEN et al. 2002), gpc-2 is expected to be also expressed in AWC sensory neurons. To confirm this, we examined the coexpression of the transcriptional reporters, Pgpc-2::venus and Podr-3::mRFP. At the first stage (L1) larvae, the expression of gpc-2 in AWC was actually observed (supplemental Figure 3).

To test if gpc-2 has any function in olfactory adaptation, we performed cell-specific RNAi by expression of sense and antisense RNA of gpc-2 by the odr-3 promoter as described above. In contrast to knockdown of gpc-1, which caused olfactory adaptation defect, the knockdown of gpc-2 did not cause olfactory adaptation defect but instead showed a small decrease of chemotaxis in mock-preexposed animals (Figure 5). The double knockdown of gpc-1 and gpc-2 caused more severe chemotaxis defect. The same was true in the knockdown of gpc-2 in the gpc-1(pe372) mutant background. These results indicate that gpc-2 acts mainly in olfactory sensation in AWC neurons and the function of gpc-1 is also contributing weakly in olfactory sensation.

To test further the functional relationship between gpc-1 and gpc-2, we overexpressed gpc-2 in gpc-1(pe372) mutant animals using the odr-3 promoter. Interestingly, expression of gpc-2 in AWC rescued the adaptation defect of gpc-1 mutants (Figure 4B). This result indicates that gpc-1 and gpc-2 have somewhat overlapping functions in olfactory adaptation. We also tested the effect of overexpression of gpc-2 in wild-type background (supplemental Figure 2B). In contrast to the overexpression of gpc-1 (Figure 4A), the overexpression of gpc-2 with neither gpb-1 nor gpb-2 showed an enhanced adaptation phenotype. In summary, the above results suggest that GPC-1 mainly acts for olfactory adaptation while GPC-2 mainly acts for olfactory sensation, but they have partially overlapping functions.

As described above, the knockdown of gpb-1 caused a decrease in chemotaxis in mock-preexposed animals, as well as a defect in olfactory adaptation. Therefore GPB-1 seems to act for both olfactory adaptation and sensation, namely, the Gβ{gamma} dimer GPC-1/GPB-1 and GPC-2/GPB-1 appear to act mainly for olfactory adaptation and olfactory sensation, respectively. We note that knockdown of gpb-1 causes much more severe defect in olfactory adaptation than double knockdown of gpc-1 and gpc-2. This might be due to the difference in RNAi efficiency between gpb-1 and gpc-1/gpc-2 (e.g., compare gpc-1 RNAi with gpc-1 mutants), or GPB-1 may have an unknown role in adaptation that requires neither GPC-1 nor GPC-2. Developmental defects in AWC or other neurons in some of the knockdown strains cannot be ruled out because GPC-2 and GPB-1 are known to be involved in mitotic spindle orientation (see DISCUSSION).

GPC-1 is mainly localized to cilia:

To observe the localization of GPC-1 in AWC sensory neurons, a construct for a fluorescent protein-fused GPC-1, venus::gpc-1, was generated and expressed in animals under the control of the odr-3 promoter. When introduced into gpc-1 mutants, the fusion gene fully rescued the adaptation defects of the animals, indicating that the Venus::GPC-1 fusion protein is functional (supplemental Figure 4E). Venus::GPC-1 was mostly localized to the cilia and a small fraction localized to the cell bodies and axons (supplemental Figure 4B). Interestingly, they were not localized to the proximal region of the axons where synapses do not exist. Thus, the localization at axons might reflect the functions of GPC-1 near the synapses. The localization of GPC-2 was also observed using venus::gpc-2. Venus::GPC-2 showed subcellular localization virtually identical to Venus::GPC-1 (supplemental Figure 4D).

Though most of the overexpressed G{gamma} probably lack Gβ to couple with, they clearly localized to the cilia. Furthermore, overexpression of gpb-1 did not affect the localization of Venus::GPC-1 (supplemental Figure 4C). Therefore, G{gamma} seems to be transported to the cilia in sensory neurons regardless of binding to Gβ.

Genetic interactions of gpc-1 with previously characterized pathways that regulate olfactory adaptation:

In mammals, G protein-coupled receptors (GPCRs) are known to be downregulated by G protein-coupled receptor kinase (GRK) and β-arrestin (FERGUSON 2001). In this process, GRK, which is recruited to the cell membrane by Gβ{gamma} dimer, phosphorylates GPCR. The phosphorylation of GPCR is followed by the recruitment of β-arrestins and internalization of GPCRs. A recent study has shown that olfactory receptors can also be inactivated by this mechanism (MASHUKOVA et al. 2006).

ARR-1, the C. elegans homolog of β-arrestin, is reported to regulate olfactory adaptation (PALMITESSA et al. 2005). According to this report, arr-1 null mutants exhibit normal chemotaxis but have defects in olfactory adaptation, whereas overexpression of arr-1 induces enhanced adaptation. However, the mutants of grk-2, which encode the C. elegans neuronal GRK, show defects of chemotaxis to various chemicals rather than adaptation defect (FUKUTO et al. 2004). Thus grk-2 is unlikely to be involved in the regulation by arr-1 and it is currently unknown how arr-1 regulates adaptation.

Given the possible link between Gβ{gamma}, β-arrestin, and olfactory adaptation, we tested the arr-1 mutants in our adaptation assay. Unexpectedly, however, the arr-1 mutants showed no adaptation defect in our assay system. This discrepancy is probably due to the difference in the assay formats of chemotaxis; our assay format is more sensitive to the avoidance response and weak chemotaxis to the odorant (see DISCUSSION). As expected, enhanced adaptation by overexpression of gpb-1 and gpc-1 was observed in the arr-1(ok401 lf) background similar to the wild-type background (Figure 6B).


Figure 6
View larger version (27K):
In this window
In a new window
Download PPT slide
 
FIGURE 6.—

egl-30, but not arr-1, let-60, or goa-1, is genetically epistatic to gpc-1. (A) The double mutants of let-60(gf) and gpc-1, and of goa-1(n1134 rf) and gpc-1(pe372), show additive defects in olfactory adaptation after 60 min of preexposure. In contrast, no additive defect was observed in the double mutant of egl-30(js126 gf) and gpc-1(pe372). (B) gpb-1 and gpc-1 were co-overexpressed in AWC sensory neurons in wild-type, arr-1(ok401lf), let-60(n1046gf), goa-1(n1134rf), and egl-30(js126gf) animals using the promoter of odr-3. arr-1(lf) animals are not defective in our paradigm and arr-1(lf) mutation does not impair the effect of coexpression of gpb-1 and gpc-1. The olfactory adaptation defects of let-60(gf) and goa-1(rf) are partially suppressed by co-overexpression of gpb-1 and gpc-1, while the olfactory adaptation phenotype of egl-30(gf) is less significantly affected (P > 0.01) by the co-overexpression. (C) Expression of a constitutively active form of goa-1, goa-1(Q205L), in AWC neurons of wild-type animals results in an enhanced adaptation phenotype. The expression of goa-1(Q205L) in gpc-1(pe372) background caused an intermediate reduction of chemotaxis. (D) The summary of genetic interaction. GPC-1 and the dimerization partners, GPB-1 act in parallel to the Go (GOA-1) pathway and may act upstream of Gq (EGL-30). GPC-2 also contributes weakly to olfactory adaptation but mainly regulate olfactory sensation. **P < 0.001; *P < 0.01.

 
We further tested genetic interactions between gpc-1 and other genes associated with olfactory adaptation, let-60 (Ras), goa-1 (Go{alpha}), and egl-30 (Gq{alpha}). let-60(n1046 gf), goa-1(n1134 rf), and egl-30(js126 gf) mutant animals show olfactory adaptation defects (HIROTSU and IINO 2005; MATSUKI et al. 2006); gf refers to gain-of-function alleles and rf refers to reduction-of-function alleles). We first generated double mutants of gpc-1(pe372 null) and each of the three mutants: let-60(gf); gpc-1(null), goa-1(rf); gpc-1(null) and egl-30(gf); gpc-1(null). The combination of gpc-1 and egl-30 behaved differently from the other two. Namely, egl-30(gf); gpc-1(null) showed adaptation defect identical to that of the egl-30(gf) single mutants. The double mutants let-60(gf); gpc-1(null) and goa-1(rf); gpc-1(null) showed severe defects after 60 min of odor preexposure, in contrast to the milder effects observed in either single mutant (Figure 6A).

To further examine the relationship between gpc-1 and the other genes, we observed the effect of Gβ{gamma} overexpression in AWC sensory neurons in the background of let-60(gf), goa-1(rf), or egl-30(gf). Effect of co-overexpression of gpb-1 and gpc-1 on adaptation was still observed in the let-60(gf) and goa-1(rf) background, but not in the egl-30(gf) background (Figure 6B).

These results suggest that egl-30 acts downstream of gpc-1 because when egl-30 is mutated to the activated form egl-30(js126gf), the adaptation phenotype is no more affected by either loss or overexpression of gpc-1. In contrast, goa-1 and let-60 appear to act genetically in parallel to goa-1, because the double mutants showed more severe defects than each single mutant, and overexpression of gpc-1 and gpb-1 still had effect in the goa-1(rf) or let-60(gf) background.

It has been reported that the expression of constitutively active form of goa-1, goa-1(Q205L), in the AWC neurons of wild-type animals causes enhanced adaptation similar to overexpression of gpc-1 and gpb-1 (MATSUKI et al. 2006; Figure 6C). Expression of goa-1(Q205L) in the gpc-1(pe372) background caused an intermediate phenotype between the gpc-1(pe372) mutant and wild-type animals expressing goa-1(Q205L) (Figure 6C). These results further suggest that goa-1 acts in parallel to gpc-1 because if gpc-1 acts downstream of goa-1(Q205L), the phenotype would not be altered by goa-1(Q205L) overexpression in gpc-1(null).

In summary, the above tests of genetic interactions suggest that egl-30 acts downstream of gpc-1 while goa-1 and let-60 acts in parallel to gpc-1. Reservations about the latter conclusion would be that in contrast to gpc-1, neither goa-1 nor let-60 alleles used were null, leaving the possibility open that either of these genes actually acts downstream of gpc-1. We consider this possibility unlikely, though, because the pattern of genetic interaction of gpc-1 with goa-1(n1134rf) or let-60(n1046gf) was very different from that with egl-30(js126gf).


DISCUSSION

The role of gpc-1 in the early phase of olfactory adaptation:

In this article, we showed that gpc-1 is required for adaptation to the AWC-sensed odorant, benzaldehyde. The defects were prominent after 5 min of preexposure, at which time wild-type animals mostly lost chemotaxis and tended to show weak aversive response to the odorant, while gpc-1 mutants were strongly attracted. However, after 60 min of preexposure, the gpc-1 mutants adapted to the odorant to the extent close to the wild type. We previously reported that gpc-1 mutants show defects in salt chemotaxis plasticity when the animals were preexposed to NaCl for 10 min but not for 60 min (TOMIOKA et al. 2006). gpc-1 mutants are also defective in adaptation to Cu2+ when the animals were exposed to the stimulus for 1 min (HILLIARD et al. 2005). These observations indicate that gpc-1 is involved in adaptation to multiple kinds of stimuli, and the defects of gpc-1 mutants may be observed only after a short preexposure to the stimuli.

There are two possible explanations for the early time point-specific effect of gpc-1 in olfactory adaptation. First, there may be two or more different mechanisms of adaptation, and gpc-1 may act specifically in one of these adaptation mechanisms. In this view, the mechanism involving GPC-1 may act only at early time points. Second, the gpc-1 mutants may not be directly involved in olfactory adaptation, but rather play a modulatory role. Although both interpretations explain why gpc-1 mutants adapt only after a long preexposure to the odorant, we prefer the first possibility because overexpression of gpc-1 and gpb-1 reduced chemotaxis in mock-treated animals, causing a behavior similar to adapted animals.

In this study, we employed the "early adaptation assay" (HIROTSU and IINO 2005). This assay is different in several aspects from the conventional adaptation assays. First, we used the bacterial strain NA22, rather than OP50, to grow worms before the assay. Second, worms are preexposed to the odorant in solution. Finally, and probably most importantly, the plate format used in chemotaxis assays (supplemental Figure 1A) is different from that typically used in the conventional adaptation assays (supplemental Figure 1B). In our format, spots of odorants, worms, and control spots are aligned in linear geometry and in close proximity. Therefore, if a fraction of worms avoid the odorant, the assay is very sensitive to this behavior, because essentially all the worms avoiding the odorant move into area B (supplemental Figure 1A). In addition, the chemotaxis index we used is more sensitive to weak positive chemotaxis. Because of these differences, worms show greatly reduced chemotaxis indexes after as short as 5 min of odorant preexposure, hence the nomenclature early adaptation. We have previously shown that mutants in the Ras-MAPK pathway show severe defects in early adaptation, while the same mutants show small or no defects in the conventional adaptation assays. We also showed that early adaptation depends on the function of interneurons AIY. On the other hand, although the arr-1 β-arrestin mutant was reported to have deficits in the conventional olfactory adaptation assay, we did not see any defect in the early adaptation assay (Figure 6B). Therefore, it is likely that there are multiple molecular and behavioral mechanisms for olfactory adaptation that probably act in different time courses, and they are manifested differently in the two types of adaptation assays. This view accounts for the previous failure to detect olfactory adaptation defect in the gpc-1 mutant in the conventional adaptation assay (JANSEN et al. 2002).

We have shown that gpc-1 acts in the AWC olfactory neurons for olfactory adaptation. In salt chemotaxis plasticity, gpc-1 was reported to act in multiple sensory neurons, ASI, ASH, and probably also ADL (HUKEMA et al. 2006). Of these, ASI mediates attractive behaviors to salt (BARGMANN and HORVITZ 1991). On the other hand, ASH and ADL are known to mediate aversive behaviors, and salt chemotaxis plasticity is likely to be generated by an interplay of these neurons (HUKEMA et al. 2006). Thus the role of gpc-1 at the cellular level is still unclear in salt chemotaxis plasticity. gpc-1 was also shown to be required for adaptation to Cu2+-avoidance behavior (HILLIARD et al. 2005). In this case, gpc-1 is likely to act in the Cu2+-sensing neuron ASH, because decrease of calcium response of ASH neurons to repeated Cu2+ stimuli is reduced in the gpc-1 mutant. The role of gpc-1 in AWC neurons might be similar to its role in ASH neurons for Cu2+ response.

In the sensory regulation described above, gpc-1 is assumed to act in response to sensory stimuli. To see when gpc-1 acts for olfactory adaptation, we performed stage-specific gpc-1 rescue experiments using the hsp-16.2 heat-shock promoter, and also tested stage-specific coexpression of gpb-1 and gpc-1 in wild-type background. However, the olfactory adaptation defect of gpc-1 mutants was not rescued by the heat shock neither in the adult stage nor the embryonic stage. Similarly, enhanced adaptation was not observed by expression of gpb-1 and gpc-1 in either developmental stage (data not shown). Therefore, at present we cannot judge whether gpc-1 acts in mature neurons for olfactory adaptation or whether it affects olfactory adaptation through its functions in development. In our heat-shock experiments, the expression by the heat-shock promoter may have not been appropriate for the function of GPC-1, for example in terms of the expression level. Alternatively, the expression of gpc-1 may be continuously required for a long period, for example from embryo to adulthood for generation and maintenance of competence for olfactory adaptation. We looked at the morphology of AWC neurons by cell-specific expression of Venus in the gpc-1 mutants, but no abnormality was observed (data not shown).

The complex of GPB-1 and GPC-1 is important for olfactory adaptation:

We demonstrated several features about the composition of the {gamma} dimers involved in olfactory responses. First, GPB-1, but not GPB-2, is required for the proper function of GPC-1 (Figure 4A). Second, GPC-2 can substitute for GPC-1 in olfactory adaptation, at least when overexpressed (Figure 4B). Third, GPC-2 is required for olfactory sensation rather than adaptation under normal conditions and GPC-1 is also weakly required for olfactory sensation (Figure 5). Finally, GPB-1 is required for both olfactory adaptation and sensation (Figure 5).

These results suggest that two G{gamma}s GPC-1 and GPC-2, and a Gβ of the Gβ1–4 subtype, GPB-1, act in AWC sensory neurons for olfactory responses probably by forming Gβ{gamma} heterodimers. The other Gβ of C. elegans, GPB-2, belongs to the Gβ5 subtype. Gβ5 acts not only with G{gamma} but also with RGS proteins. In egg laying and locomotion, GPB-2 is known to act with RGS, EGL-10, and EAT-16 (KOELLE and HORVITZ 1996; HAJDU-CRONIN et al. 1999). We have previously reported that gpb-2 weakly contributes to olfactory adaptation probably through EGL-10 RGS signaling (MATSUKI et al. 2006). However, we did not observe any functional association of gpb-2 with gpc-1 in the co-overexpression experiments in this study (Figure 4A). This result suggests that GPB-2 regulates olfactory adaptation without coupling with GPC-1, but probably by directly coupling with the RGS.

In the cell-specific knockdown, we detected differential functions of GPC-1 and GPC-2: GPC-1 biased to adaptation and GPC-2 biased to sensation. Therefore the functions of GPC-1 and GPC-2 are basically distinct but partially overlapping. Comparison of the knockdown phenotype of gpb-1 with that of gpc-1 and gpc-2 suggests that GPB-1 acts with both GPC-1 and GPC-2. Therefore it is presumed that GPB-1/GPC-1 and GPB-1/GPC-2 serve differential but overlapping functions. This functional differentiation could be explained by assuming that each of the two Gβ{gamma} complexes interact with multiple target proteins with different affinities, and this assumption is consistent with the known mode of interaction where the Gβ{gamma} dimers interact with their effectors on the Gβ face with an influence by the G{gamma} subunit (CABRERA-VERA et al. 2003).

In G protein signaling, either G{alpha} or Gβ{gamma} subunits can act as an effector subunit. For Gβ{gamma}, various targets are known, such as K+ and Ca2+ channels, adenylyl cyclase, phospholipase Cβ (PLC-β), PI 3-kinase, G protein-coupled receptor kinase (GRK), and other protein kinases (CLAPHAM and NEER 1997; CABRERA-VERA et al. 2003). Of these, GRK acts with β-arrestin for downregulation of many GPCRs (FERGUSON 2001). The mutant animals of arr-1, which is the β-arrestin homolog in C. elegans, are reported to have defects in olfactory adaptation. Furthermore, they also showed defects in salt chemotaxis plasticity comparable to that of gpc-1 mutants (HUKEMA et al. 2006). Therefore, GRK-β-arrestin pathway was one of the strongest candidates for a GPC-1 target in olfactory adaptation. However, in our assay, the arr-1 mutant did not show any discernible defect, in clear contrast with gpc-1. Therefore, GPC-1 is unlikely to act on the GRK/β-arrestin regulatory system.

By testing other mutants that show abnormality in olfactory adaptation, we showed that gpc-1 genetically acts in parallel to let-60 and goa-1, and upstream of egl-30. In olfactory adaptation, we previously reported that goa-1 genetically acts upstream of egl-30 (MATSUKI et al. 2006). Thus, both goa-1 and gpc-1 may regulate egl-30 in parallel (Figure 6D). Other than the role as effector subunits of G proteins, Gβ{gamma} dimers possibly regulate the activity of G{alpha} directly. A Gβ{gamma} dimer binds the GDP-bound form of G{alpha} most tightly and thus suppresses spontaneous G{alpha} activation. In contrast, binding of a Gβ{gamma} dimer to the GTP-bound form of G{alpha} is also reported to compete with GTPase activating proteins (GAPs) (TANG et al. 2006), which accelerate hydrolysis of GTP, hence inactivation of G{alpha}. Therefore, both activation and inactivation are possible for the effect of Gβ{gamma} on G{alpha}. Our data suggest that GPC-1 negatively regulates EGL-30 Gq{alpha}. The activity of EGL-30 may be directly affected by the Gβ{gamma} dimers, or through an intervening signaling pathway. The possibilities suggested by our genetical analyses needs to be biochemically tested in future studies.


ACKNOWLEDGEMENTS
We thank Yuji Kohara for providing cDNA clones and Caenorhabditis Genetic Center, which is funded by National Institutes of Health National Center for Research Resources, for all the strains used in this study. We also thank members of our laboratory for useful advice and discussion.


FOOTNOTES
1 Present address: Innovative Biology Labs, R&D Eisai Co., Tsukuba-shi Ibaraki 300-2635, Japan. Back


LITERATURE CITED

BARGMANN, C. I., and H. R. HORVITZ, 1991 Chemosensory neurons with overlapping functions direct chemotaxis to multiple chemicals in C. elegans. Neuron 7: 729–742.[CrossRef][Medline]

BARGMANN, C. I., E. HARTWIEG and H. R. HORVITZ, 1993 Odorant-selective genes and neurons mediate olfaction in C. elegans. Cell 74: 515–527.[CrossRef][Medline]

BRENNER, S., 1974 The genetics of Caenorhabditis elegans. Genetics 77: 71–94.[Abstract/Free Full Text]

CABRERA-VERA, T. M., J. VANHAUWE, T. O. THOMAS, M. MEDKOVA, A. PREININGER et al., 2003 Insights into G protein structure, function, and regulation. Endocr. Rev. 24: 765–781.[Abstract/Free Full Text]

CLAPHAM, D. E., and E. J. NEER, 1997 G protein beta gamma subunits. Annu. Rev. Pharmacol. Toxicol. 37: 167–203.[CrossRef][Medline]

COBURN, C. M., and C. I. BARGMANN, 1996 A putative cyclic nucleotide-gated channel is required for sensory development and function in C. elegans. Neuron 17: 695–706.[CrossRef][Medline]

COLBERT, H. A., and C. I. BARGMANN, 1995 Odorant-specific adaptation pathways generate olfactory plasticity in C. elegans. Neuron 14: 803–812.[CrossRef][Medline]

COLBERT, H. A., and C. I. BARGMANN, 1997 Environmental signals modulate olfactory acuity, discrimination, and memory in Caenorhabditis elegans. Learn. Mem. 4: 179–191.[Abstract/Free Full Text]

COLBERT, H. A., T. L. SMITH and C. I. BARGMANN, 1997 OSM-9, a novel protein with structural similarity to channels, is required for olfaction, mechanosensation, and olfactory adaptation in Caenorhabditis elegans. J. .Neurosci. 17: 8259–8269.[Abstract/Free Full Text]

ESPOSITO, G., E. DI SCHIAVI, C. BERGAMASCO and P. BAZZICALUPO, 2007 Efficient and cell specific knock-down of gene function in targeted C. elegans neurons. Gene 395: 170–176.[CrossRef][Medline]

FERGUSON, S. S., 2001 Evolving concepts in G protein-coupled receptor endocytosis: the role in receptor desensitization and signaling. Pharmacol. Rev. 53: 1–24.[Abstract/Free Full Text]

FUKUTO, H. S., D. M. FERKEY, A. J. APICELLA, H. LANS, T. SHARMEEN et al., 2004 G protein-coupled receptor kinase function is essential for chemosensation in C. elegans. Neuron 42: 581–593.[CrossRef][Medline]

GOTTA, M., and J. AHRINGER, 2001 Distinct roles for Galpha and Gbetagamma in regulating spindle position and orientation in Caenorhabditis elegans embryos. Nat. Cell Biol. 3: 297–300.[CrossRef][Medline]

HAJDU-CRONIN, Y. M., W. J. CHEN, G. PATIKOGLOU, M. R. KOELLE and P. W. STERNBERG, 1999 Antagonism between G(o)alpha and G(q)alpha in Caenorhabditis elegans: the RGS protein EAT-16 is necessary for G(o)alpha signaling and regulates G(q)alpha activity. Genes Dev. 13: 1780–1793.[Abstract/Free Full Text]

HILLIARD, M. A., A. J. APICELLA, R. KERR, H. SUZUKI, P. BAZZICALUPO et al., 2005 In vivo imaging of C. elegans ASH neurons: cellular response and adaptation to chemical repellents. EMBO J. 24: 63–72.[CrossRef][Medline]

HIROTSU, T., and Y. IINO, 2005 Neural circuit-dependent odor adaptation in C. elegans is regulated by the Ras-MAPK pathway. Genes Cells 10: 517–530.[CrossRef][Medline]

HIROTSU, T., S. SAEKI, M. YAMAMOTO and Y. IINO, 2000 The Ras-MAPK pathway is important for olfaction in Caenorhabditis elegans. Nature 404: 289–293.[CrossRef][Medline]

HUKEMA, R. K., S. RADEMAKERS, M. P. DEKKERS, J. BURGHOORN and G. JANSEN, 2006 Antagonistic sensory cues generate gustatory plasticity in Caenorhabditis elegans. EMBO J. 25: 312–322.[CrossRef][Medline]

JANSEN, G., K. L. THIJSSEN, P. WERNER, M. VAN DER HORST, E. HAZENDONK et al., 1999 The complete family of genes encoding G proteins of Caenorhabditis elegans. Nat. Genet. 21: 414–419.[CrossRef][Medline]

JANSEN, G., D. WEINKOVE and R. H. PLASTERK, 2002 The G-protein gamma subunit gpc-1 of the nematode C.elegans is involved in taste adaptation. EMBO J. 21: 986–994.[CrossRef][Medline]

KOELLE, M. R., and H. R. HORVITZ, 1996 EGL-10 regulates G protein signaling in the C. elegans nervous system and shares a conserved domain with many mammalian proteins. Cell 84: 115–125.[CrossRef][Medline]

KOGA, M., and Y. OHSHIMA, 2004 The C. elegans ceh-36 gene encodes a putative homemodomain transcription factor involved in chemosensory functions of ASE and AWC neurons. J. Mol. Biol. 336: 579–587.[CrossRef][Medline]

LANS, H., S. RADEMAKERS and G. JANSEN, 2004 A network of stimulatory and inhibitory G{alpha}-subunits regulates olfaction in Caenorhabditis elegans. Genetics 167: 1677–1687.[Abstract/Free Full Text]

LAW, E., W. M. NUTTLEY and D. VAN DER KOOY, 2004 Contextual taste cues modulate olfactory learning in C. elegans by an occasion-setting mechanism. Curr. Biol. 14: 1303–1308.[CrossRef][Medline]

L'ETOILE, N. D., and C. I. BARGMANN, 2000 Olfaction and odor discrimination are mediated by the C. elegans guanylyl cyclase ODR-1. Neuron 25: 575–586.[CrossRef][Medline]

L'ETOILE, N. D., C. M. COBURN, J. EASTHAM, A. KISTLER, G. GALLEGOS et al., 2002 The cyclic GMP-dependent protein kinase EGL-4 regulates olfactory adaptation in C. elegans. Neuron 36: 1079–1089.[CrossRef][Medline]

MASHUKOVA, A., M. SPEHR, H. HATT and E. M. NEUHAUS, 2006 Beta-arrestin2-mediated internalization of mammalian odorant receptors. J. Neurosci. 26: 9902–9912.[Abstract/Free Full Text]

MATSUKI, M., H. KUNITOMO and Y. IINO, 2006 Go{alpha} regulates olfactory adaptation by antagonizing Gq{alpha}-DAG signaling in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 103: 1112–1117.[Abstract/Free Full Text]

MIYAHARA, K., N. SUZUKI, T. ISHIHARA, E. TSUCHIYA and I. KATSURA, 2004 TBX2/TBX3 transcriptional factor homologue controls olfactory adaptation in Caenorhabditis elegans. J. Neurobiol. 58: 392–402.[CrossRef][Medline]

NUTTLEY, W. M., S. HARBINDER and D. VAN DER KOOY, 2001 Regulation of distinct attractive and aversive mechanisms mediating benzaldehyde chemotaxis in Caenorhabditis elegans. Learn. Mem. 8: 170–181.[Abstract/Free Full Text]

NUTTLEY, W. M., K. P. ATKINSON-LEADBEATER and D. VAN DER KOOY, 2002 Serotonin mediates food-odor associative learning in the nematode Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 99: 12449–12454.[Abstract/Free Full Text]

PALMITESSA, A., H. A. HESS, I. A. BANY, Y. M. KIM, M. R. KOELLE et al., 2005 Caenorhabditis elegans arrestin regulates neural G protein signaling and olfactory adaptation and recovery. J. Biol. Chem. 280: 24649–24662.[Abstract/Free Full Text]

ROAYAIE, K., J. G. CRUMP, A. SAGASTI and C. I. BARGMANN, 1998 The G{alpha} protein ODR-3 mediates olfactory and nociceptive function and controls cilium morphogenesis in C. elegans olfactory neurons. Neuron 20: 55–67.[CrossRef][Medline]

SAEKI, S., M. YAMAMOTO and Y. IINO, 2001 Plasticity of chemotaxis revealed by paired presentation of a chemoattractant and starvation in the nematode Caenorhabditis elegans. J. Exp. Biol. 204: 1757–1764.[Abstract]

TANG, W., Y. TU, S. K. NAYAK, J. WOODSON, M. JEHL et al., 2006 Gβ{gamma} inhibits G{alpha} GTPase-activating proteins by inhibition of G{alpha}-GTP binding during stimulation by receptor. J. Biol. Chem. 281: 4746–4753.[Abstract/Free Full Text]

TOMIOKA, M., T. ADACHI, H. SUZUKI, H. KUNITOMO, W. R. SCHAFER et al., 2006 The insulin/PI 3-kinase pathway regulates salt chemotaxis learning in Caenorhabditis elegans. Neuron 51: 613–625.[CrossRef][Medline]

TROEMEL, E. R., J. H. CHOU, N. D. DWYER, H. A. COLBERT and C. I. BARGMANN, 1995 Divergent seven transmembrane receptors are candidate chemosensory receptors in C. elegans. Cell 83: 207–218.[CrossRef][Medline]

TROEMEL, E. R., A. SAGASTI and C. I. BARGMANN, 1999 Lateral signaling mediated by axon contact and calcium entry regulates asymmetric odorant receptor expression in C. elegans. Cell 99: 387–398.[CrossRef][Medline]

UCHIDA, O., H. NAKANO, M. KOGA and Y. OHSHIMA, 2003 The C. elegans che-1 gene encodes a zinc finger transcription factor required for specification of the ASE chemosensory neurons. Development 130: 1215–1224.[Abstract/Free Full Text]

WES, P. D., and C. I. BARGMANN, 2001 C. elegans odour discrimination requires asymmetric diversity in olfactory neurons. Nature 410: 698–701.[CrossRef][Medline]

WICKS, S. R., R. T. YEH, W. R. GISH, R. H. WATERSTON and R. H. PLASTERK, 2001 Rapid gene mapping in Caenorhabditis elegans using a high density polymorphism map. Nat. Genet. 28: 160–164.[CrossRef][Medline]

ZUFALL, F., and T. LEINDERS-ZUFALL, 2000 The cellular and molecular basis of odor adaptation. Chem. Senses 25: 473–481.[Abstract/Free Full Text]

ZWAAL, R. R., J. AHRINGER, H. G. VAN LUENEN, A. RUSHFORTH, P. ANDERSON et al., 1996 G proteins are required for spatial orientation of early cell cleavages in C. elegans embryos. Cell 86: 619–629.[CrossRef][Medline]

Communicating editor: K. KEMPHUES