Schizosaccharomyces pombe Rho1p is essential, directly activates β-1,3-glucan synthase, and participates in the regulation of morphogenesis. In S. pombe, Rho1p is activated by at least three guanine nucleotide exchange factors (GEFs): Rgf1p, Rgf2p, and Rgf3p. In this study we show that Rgf2p is a Rho1p GEF required for sporulation. The rgf2⁺ deletion did not affect forespore membrane formation and the nuclei were encapsulated properly. However, the mutant ascospores appeared dark and immature. The rgf2 zygotes were not able to release the ascospores spontaneously, and the germination efficiency was greatly reduced compared to wild-type (wt) spores. This phenotype resembles that of the mutants in bgs2⁺, which encodes a sporulation-specific glucan synthase subunit. In fact, glucan synthase activity was diminished in sporulating rgf2 diploids. Rgf2p also plays a role in β-glucan biosynthesis during vegetative growth. Overexpression of rgf2⁺ specifically increased GTP-bound Rho1p, caused changes in cell morphology, and elicited an increase in β-1,3-glucan synthase activity. Moreover, the simultaneous disruption of rgf1⁺ and rgf2⁺ was lethal and both Rgf1p and Rgf2p were able to partially substitute for each other. Our results suggest that Rgf1p and Rgf2p are alternative GEFs with an essential overlapping function in Rho1p activation during vegetative growth.

---

SCHIZOSACCHAROMYCES pombe cells are rod shaped, grow mainly by elongation of their ends, and divide by binary fission after forming a centrally placed division septum (HAYLES and NURSE 2001). Upon nutrient starvation, especially that of nitrogen, S. pombe cells exit the mitotic cycle at G1 and proceed through mating and two meiotic divisions to generate four haploid spores (EGEL 2004; SHIMODA and NAKAMURA 2004; YAMAMOTO 2004). In each of these polarization states, a new membrane and cell wall are necessary to preserve cellular shape and integrity.

The cell wall is a rigid structure that protects yeast cells, controlling all communication with the extracellular world. However, the cell wall must be loosened to allow expansion during periods of polarized growth, while it needs to be constrained when cells are growing in poor substrate conditions (LEVIN 2005; LATGÉ 2007). The S. pombe cell wall mainly consists of an outer layer rich in galactomannoproteins and an inner layer of β-1,3-, β-1,6-, and -1,3-glucans (MANNERS and MEYER 1977; DURÁN and PÉREZ 2004). Among the polysaccharides, we focused on the β-1,3-glucan fibrillar network. β-1,3-glucan is the major structural component and is also the first polymer to be synthesized in regenerating protoplasts (OSUMI et al. 1989) and in the S. pombe spore wall (MARTÍN et al. 2000; GARCÍA et al. 2006). β-1,3-glucan biosynthesis is carried out by the β-1,3-glucan synthase complex (GS), a multimeric enzyme composed of both catalytic and regulatory subunits. The catalytic component is encoded by the bgs family of genes (bgs1⁺, bgs2⁺, bgs3⁺, and bgs4⁺) (LE GOFF et al. 1999; LIU et al. 2000b, 2002; MARTÍN et al. 2000, 2003; CORTÉS et al. 2005, 2007), while the regulatory component is the GTPase Rho1p (ARELLANO et al. 1996). The biochemistry of the GS complex has been characterized, but the assembly process and the activation mechanisms that polarize cell wall extension only to certain areas of the cell wall remain largely unknown. There is accumulating evidence that Bgs (β-GS) might be controlled by local/temporal activation of Rho1p. Rho1p acts as a binary switch, cycling between an inactive GDP-bound and an active GTP-bound conformational state, stimulating GS in its GTP-bound prenylated form (ARELLANO et al. 1996, 1997; NAKANO et al. 1997). During vegetative growth, Rho1p travels to the growth sites, poles, and septum to meet Bgs1p, Bgs3p, and Bgs4p. The three GS catalytic subunits localize to the poles during tip elongation and to the septum during cytokinesis; all of them are large integral membrane proteins whose levels do not fluctuate along the cell cycle (LIU et al. 2002; MARTÍN et al. 2003). Bgs1p is required for primary septum formation (CORTÉS et al. 2007), while Bgs3p and Bgs4p are good candidates for the synthesis of the β-1,3-glucan of the surrounding cell wall and the secondary septum, both with a similar composition (HUMBEL et al. 2001; CORTÉS et al. 2005). β-1,3-glucan also accounts for 38% of the polysaccharides present in the spore wall (GARCÍA et al. 2006). In spores, β-1,3-glucan synthesis is carried out by Bgs2p, the GS catalytic subunit specific for sporulation (LIU et al. 2000; MARTÍN et al. 2000). Bgs2p is required for proper spore wall maturation and in its absence the spores are not released from the ascal sac and are unable to germinate (MARTÍN et al. 2000).

For GS activation, as well as for other functions, Rho1p must be precisely regulated in response to temporally preceding upstream signals. This regulation mainly involves two types of proteins: guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) (ROSSMAN et al. 2005a; BOS et al. 2007). GEFs turn on signaling by catalyzing the exchange from G-protein-bound GDP to GTP, whereas GAPs terminate signaling by inducing GTP hydrolysis. All these proteins are multidomain proteins and play important roles in the specificity of Rho functions. In S. pombe there are at least three GEFs (Rgf1p, Rgf2p, and Rgf3p) (GARCÍA et al. 2006b), and several putative GAPs (Rga1p, Rga5p, and Rga8p) (NAKANO et al. 2001; CALONGE et al. 2003; YANG et al. 2003), all of them specific for Rho1p.

Among the activators, rgf3⁺ was first cloned in our laboratory by complementation of a mutant (ehs2-1) hypersensitive to drugs that interfere with cell wall biosynthesis (TAJADURA et al. 2004). rgf3⁺ is essential for cell viability and the protein localizes exclusively to the middle region of the cell (TAJADURA et al. 2004; MORRELL-FALVEY et al. 2005; MUTOH et al. 2005). Rgf3p activates GS and increases the amount of cell wall β-1,3-glucan. Thus, it is probable that Rgf3p stimulates Rho1p-mediated activation of a type of GS activity that is crucial for proper septum function (TAJADURA et al. 2004). Rgf1p is not essential for viability, but it does play an important role in regulating the growth pattern of fission yeast cells and signals upstream from the Pmk1 mitogen-activated protein kinase pathway (GARCÍA et al. 2006a, 2009). Rgf1p localizes to the cell tips in interphase cells and to the division septum in mitotic cells, and it activates the β-GS complex containing the catalytic subunit Bgs4p (MORRELL-FALVEY et al. 2005; MUTOH et al. 2005; GARCÍA et al. 2006a). Moreover, Rgf1p is required for actin reorganization necessary for cells to change from monopolar to bipolar growth during new end take off (NETO), thus coupling a cell polarity transition to cell wall biogenesis (GARCÍA et al. 2006a). On the basis of two-hybrid analysis and its protein sequence (MUTOH et al. 2005), Rgf2p has been proposed to be a Rho1p GEF. Rgf1p and Rgf2p are the closest relatives—63.4% identity within the DH domains—but while rgf1 cells are hypersensitive to cell wall-damaging agents and other types of stress, rgf2 cells are similar to wild-type (wt) cells and Rgf2p is not required for cell elongation or assembly of the division septum.

Here we report that simultaneous depletion of Rgf1p and Rgf2p is lethal in vegetative cells and that mild overexpression of rgf2⁺ fully rescues the lysis and hypersensitivity to caspofungin, which interferes with cell wall integrity, of rgf1 cells. Our data strongly suggest that Rgf1p and Rgf2p share an essential function as Rho1p activators during vegetative growth. In addition, Rgf2p appears to play an essential function as a GS activator during the sporulation process. Following meiosis, rgf2-null mutants failed to properly assemble the spore wall, resulting in the formation of immature spores. The subcellular localization of Rgf2p supports its role in spore wall assembly.

Media, reagents and genetics:

The genotypes of the S. pombe strains used in this study are listed in Table 1. The complete yeast growth medium (YES), selective medium (MM) supplemented with the appropriate requirements, and sporulation medium (MEA) have been described elsewhere (MORENO et al. 1991). Caspofungin (Csp) was stored at –20° in a stock solution (2.5 mg/ml) in H₂O and was added to the media after autoclaving at the corresponding final concentration. Crosses were performed by mixing appropriate strains directly on MEA plates and diploids allowed to sporulate at 28°. Recombinant strains were obtained by tetrad analysis. For synchronous meiosis, diploid strains homozygous for pat1-114^ts were cultured in MM –N at 24° for 18 hr, after which the temperature was shifted to 34° to induce meiosis (IINO et al. 1995). For overexpression experiments using the nmt1 promoter, cells were grown to logarithmic phase in EMM containing 15 µM thiamine. Cells were harvested, washed three times with water, and inoculated in fresh medium (without thiamine) at an OD₆₀₀ = 0.01.

View this table: In this window In a new window   TABLE 1 S. pombe strains used in this work

 

Disruption of the rgf2⁺ gene:

The rgf2::ura4⁺ disruption construct was obtained in a two-step process. The 5' noncoding region of the rgf2⁺ ORF [nucleotides (nt) –1475 to –23] was amplified by PCR, inserting the ApaI and SalI sites (one at each end), and was ligated into the same sites of the SK-ura4⁺ vector. The 3' flanking region of the rgf2⁺ ORF (nt +3604–5241) was amplified by PCR, inserting the BamHI and NotI sites as above, and was cloned into the same sites of pSK-ura⁺ with the 5' end, to yield pGR2. rgf2⁺ gene disruption was accomplished using the 4.7-kb fragment from pGR2 cut with ApaI and NotI and transforming the YS165 diploid strain. Transformants were replica plated five times consecutively on YES medium to eliminate cells that had not integrated the construct. Integration was analyzed by PCR using the following oligonucleotides: IPCR-b (5'-CACCATGCCAAAAATT ACACAAGATAGAAT-3') in the ura4⁺ gene; Rom3-ext-3' (5'-GAGACGGTAAAATCACG-3') downstream from nucleotide +5311, and therefore external to the disruption cassette; Rom3-int-3' (5'-TCCAGCAAATGCAGCAG-3') in the rgf2⁺ gene. A diploid strain heterozygous for the rgf2::ura4⁺ allele was subjected to tetrad analysis. 2ura4⁺:2ura4^– segregation was observed, indicating that rgf2⁺ is not essential for vegetative growth. To make the rgf2::his disruption construct (pRZ38), the upstream ApaI–SalI fragment and the downstream 1.6-kb BamHI–NotI fragment were ligated into the same sites of pSK-his3⁺. Plasmid pRZ38 was digested with ApaI and NotI and the linear DNA containing the cassette was used to transform a haploid strain (YS64). rgf2::his3 disruptants (GRG55) were tested for stability and analyzed by PCR.

Construction of plasmids and strains:

rgf2⁺ was obtained from cosmid SPA1006. First, upstream (1.4 kb) and downstream (1.6 kb) flanking sequences from rgf2⁺ obtained by PCR amplification were subcloned into ApaI–SalI and BamHI–NotI from pAL-KS (S. pombe ars1⁺ and S. cerevisiae LEU2 selection) to make plasmid pGR3. Then, we cloned a 3.7-kb XhoI–SphI fragment from cosmid SPA1006 (containing the rgf2⁺ ORF) into pGR3 (cut with XhoI–SphI) to obtain pGR13, bearing the entire rgf2⁺ ORF and flanking sequences. To tag Rgf2p at the C terminus with enhanced green fluorescent protein (engineered with 8 alanines at the N terminus) and with the triple repeat of the influenza virus hemagglutinin epitope (HA) (CRAVEN et al. 1998), pAL-rgf2⁺ (pGR13) was modified by site-directed mutagenesis. We destroyed the NotI site at the multiple cloning site and created a NotI site by site-directed mutagenesis three nt before the TAG stop codon of rgf2⁺ (pGR39). The 8ala-GFP and HA epitopes were inserted in-frame at the NotI site of pGR39. pGR76 (pAL-rgf2⁺-8ala-GFP) and pGR51 (pAL-rgf2⁺-HA) fully complemented the rgf2 phenotypes. Strain (PG260), containing a chromosomal copy of rgf2⁺ tagged with 8ala-GFP, was obtained using a PCR-based approach, as described by (BÄHLER et al. 1998). The primers 5'-CAATTCCATTTTCATCTGGAGAAAATCCTATAGTTCATTCTTTAATACTTCCTCCAGCAAATGCAGCAGGTCCTGCACTTGGTGGTGGTGGTGGGATCCCCGGGTTAATTAA-3' and 5'-GGTCATAGATTCTTGAAGCTTAGATTGTAATAGCATATATTATAATCAATTGATGTGGCATGCAAAAGATGTCCGGAGTAGGAATTCGAGCTCGTTTAAAC-3' were used to amplify GFP-kan from pFA6a-GFP(S65T)-kanMX6. The same approach was used to construct the strain (PG115) with the endogenous rgf1⁺ gene driven by the 81Xnmt promoter. The primers 5'-GTAACCAATGCGAACGCAATTAAAATAAAATAAGTCAATACAGCATAGTCATAGAAATCGATCAATTGTTATCCGGAGAATTCGAGCTCGTTTAAA-3' and 5'-CTTGGAGCACCAAAAATTTCCTCATAAGCACGCGAGCTCTCATTCACACCGAGTGCATTTGGATGCCGTAATCCATTGCCATGATTTAACAAAGCGACTATA-3' were used to amplify kan-P81xnmt from pFA6a-kanMX6-P81nmt. To make strain GRG33, P81nmt-rgf1 rgf2, the rgf2::ura4⁺ disruption cassette from pGR2 was used to transform PG115 cells carrying the endogenous rgf1⁺ promoter replaced by the P81nmt promoter. To make strain PG94, P81nmt-rgf3 rgf1, the rgf1::his3⁺ disruption cassette (GARCÍA et al. 2006a) was used to transform VT88 cells carrying the rgf3⁺ gene driven by the P81nmt promoter (TAJADURA et al. 2004). Strain PG395, P81nmt-rgf3 rgf1, was obtained from VT88 cells carrying the rgf3⁺ gene driven by the P81nmt promoter, transformed with the rgf2::his3⁺ disruption cassette and analyzed by PCR.

For rgf2⁺ overexpression, pGR13 (pAL-rgf2⁺) was modified by site-directed mutagenesis, introducing XhoI and SmaI sites flanking the rgf2⁺ ORF and thus creating pGR69. The rgf2⁺ ORF from pGR69 was cloned into the same sites of pREP3X, pREP41X, and pREP81X, thus making pGR70, pGR71, and pGR72, respectively. For pREP3X-rgf2-PTTR (pGR93), the rgf2⁺ ORF from pGR69 was mutagenized by site-directed mutagenesis to eliminate the sequence "cctacgactcgc." The mutated ORF was subcloned as a XhoI–SmaI fragment into the same sites of pREP3X. To overexpress rgf2⁺ tagged with HA or GFP, the rgf2⁺ ORF was obtained from pGR51 (pAL-rgf2⁺-HA) or pGR76 (pAL-rgf2⁺-8ala-GFP), respectively. pGR83 is pREP41X-rgf2⁺-HA; pGR84 is pREP41X-rgf2⁺-8ala-GFP; pGR85 is pREP3X-rgf2⁺-HA; and pGR86 is pREP3X-rgf2⁺-8ala-GFP. Plasmid pNG45, bearing the rgf1⁺ ORF under the control of the rgf2⁺ promoter, was obtained by eliminating the nmt1 promoter from pGR33 (pREP3X-rgf1⁺) by digestion with PstI–NcoI and replacing it with the rgf2⁺ promoter obtained by PCR with PstI–NcoI tails. pREP3X-rho1⁺ was kindly provided by P. Perez and is described in ARELLANO et al. (1996).

Cell wall analyses:

Enzyme preparations and GS assays were essentially performed as described previously (MARTÍN et al. 2000). Cells (1 x 10⁹) were harvested, washed twice with buffer A (50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1 mM β-mercaptoethanol), and resuspended in 100 µl of the same buffer. Lysis was achieved in a Fast-Prep device, using 0.4 g of glass beads and spinning three times for 15 sec at a speed setting of 5. The resulting homogenates were collected by adding 3 ml of buffer A. The cell walls were removed by low-speed centrifugation (5000 g for 5 min at 4°). The supernatant was centrifuged for 30 min at 48,000 g, and the membrane pellet was resuspended in 0.3 ml of buffer A containing 33% glycerol and stored at –70°. Standard GS assays contained 15–25 µg protein of enzyme extract (3–5 mg protein/ml) in a total volume of 40 µl, and the reaction mixture was incubated at 30° for 60–90 min. All reactions were carried out in duplicate and values were calculated from two independent cell cultures. One unit of activity was measured as the amount that catalyses the uptake of 1 µmol of substrate (UDP-D-glucose) min^–1 at 30°.

Pull-down assay for GTP-bound Rho proteins:

The expression vector pGEX-C21RBD (rhotekin-binding domain) (REID et al. 1996) was used to transform Escherichia coli cells. The fusion protein was produced according to the manufacturer's instructions and immobilized on glutathione-sepharose 4B beads (Amersham). After incubation, the beads were washed several times and the bound proteins were analyzed by SDS–PAGE and stained with Coomassie brilliant blue. The amount of GTP-bound Rho proteins was analyzed using the Rho-GTP pull-down assay modified after REN et al. (1999). Briefly, extracts from 50-ml cultures of wild-type cells transformed with pREP3X, pREP3X-rgf2⁺ (pGR70), or pREP3X-rgf2-PTTR (pGR93), containing HA-rho1⁺ expressed from its own promoter, were obtained using 200 µl of lysis buffer (50 mM Tris, pH 7.5, 20 mM NaCl, 0.5% NP-40, 10% glycerol, 0.1 mM dithiothreitol, 1 mM NaCl, 2 mM MgCl₂, containing 100 µM p-aminophenyl methanesulfonyl fluoride, leupeptin, and aprotinin). One hundred micrograms of GST-RBD fusion protein coupled to glutathione-agarose beads was used to immunoprecipitate 1.5 mg of cell lysates. The extracts were incubated with GST-RBD beads for 2 hr. The beads were then washed with lysis buffer four times, and bound proteins were blotted against 1:5000-diluted 12CA5 mAb as primary antibody to detect HA-Rho1p. The total amount of HA-Rho1p was monitored in whole-cell extracts (25 µg of total protein), which were used directly for Western blot and were developed with 12CA5 mAb. Immunodetection was accomplished using the ECL detection kit (Amersham Biosciences).

Microscopy techniques:

The localization of Rgf2p-GFP was visualized in living cells. For Calcofluor staining, exponentially growing S. pombe cells were harvested, washed once, and resuspended in water with Calcofluor white (Cfw) at a final concentration of 20 µg/ml for 5 min at room temperature. After washing with water, the cells were observed under a DMRXA microscope (Leica, Wetzlar, Germany).

Rgf2p is required for ascospore development:

Rgf2p belongs to a family of GEFs in S. pombe (GARCÍA et al. 2006b) (http://www.genedb.org/genedb/pombe/index.jsp). Rgf2p contains a putative Dbl homology domain (DH) [amino acid residues (aa) 461–633] found in proteins responsible for the activation of Rho-family GTPases). Adjacent and C-terminal to the DH domain is a pleckstrin homology domain (PH) (aa 670–805), which has been proposed to localize GEF proteins to the plasma membrane and to regulate their GEF activity through allosteric mechanisms (ROSSMAN and SONDEK 2005b). Apart from the DH-PH module, Rgf2p contains at least two additional predicted functional domains: a DEP (Dishevelled, Egl-10, and Pleckstrin) domain (aa 212–287) and a CNH (Citron and NIK1-like kinase homology domain) (aa 827–1120) (Figure 1A). Within the GEF family, the closest relative to Rgf2p is Rgf1p (GARCÍA et al. 2006b). The percentage of identity between the deduced amino acid sequence of the DH domain of Rgf2p and Rgf1p is 63.4%, while the identity is <20% between the DH domain of Rgf2p and Rgf3p, Scd1p, and Gef1p. Moreover, the distribution of the DEP, DH-PH, and CNH domains is similar in both proteins, suggesting that the N terminus is shorter in Rgf2p, although this has yet to be proved.

View larger version (73K): In this window In a new window Download PPT slide   FIGURE 1.— Rgf2p is required for ascospore development. (A) Schematic of the structural features of the Rgf2 protein analyzed by the SMART program (http://smart.embl-heidelberg.de/). Domains are indicated: DEP is present in signaling molecules and is responsible for mediating intracellular protein targeting (CHEN and HAMM 2006); RhoGEF/DH domain (Dbl homology domain), conserved among GEFs for Rho/Rac/Cdc42-like GTPases; PH, pleckstrin homology domain (ROSSMAN and SONDEK 2005b); CNH, citron homology domain, required for protein–protein interaction (TAIRA et al. 2004). (B) Sporulation phenotype of wild-type (YS64 x YS71) and rgf2 (PG1 x PG5) cells incubated for 24 hr on MEA. Phase contrast micrographs are shown on the left and Nomarsky micrographs are shown on the right. (C) rgf2+ mRNA is highly induced during meiosis. Synchronous meiosis was induced in diploid cells carrying the pat1-114ts temperature-sensitive allele by a temperature upshift (34°) after overnight incubation in nitrogen-free medium at the permissive temperature (25°). The kinetics of meiosis in the pat1-114ts mutant was followed by staining a portion of the culture every 2 hr with Hoechst stain and is shown in the graph. Total RNA samples were prepared at the indicated times and subjected to Northern blot analysis. Ethidium bromide staining of rRNA is presented as a loading control.

 
To investigate the function of rgf2⁺ in greater depth, we constructed and examined the phenotypes of S. pombe strains in which rgf2⁺ had been deleted (see MATERIALS AND METHODS) (Figure 1). Haploid rgf2 transformants were obtained as readily as diploid transformants, indicating that rgf2⁺ was not required for cell growth. rgf2 cells did not exhibit any evident morphological changes, as judged by light microscopy, and the rgf2 strain grew well under standard growth conditions at either 28° or 37° and entered stationary phase at the same time as the wild-type cultures. We noted that rgf2 cells even grew slightly faster than wild-type cells (not shown). We also examined cell viability of stationary phase rgf2 and rgf2⁺ cultures incubated for 4 days at 28°; both strains were found to be >90% viable during this period.

Next, we looked at the effect of the mutation on mating and sporulation. The mating rate was not affected in rgf2h⁺ x rgf2h^– crosses (data not shown), but we did observe a sporulation defect. In wild type, 70% of the culture showed refringent ascospores after 24 hr. By contrast, no examples of mature asci were observed in the rgf2 mutant. The rgf2 zygotes appeared dark, although it was possible to differentiate the outline of the four ascospores inside the asci (Figure 1B). The sporulation defect seen in rgf2 homozygous zygotes was rescued by the plasmid carrying the rgf2⁺ gene (pGR13), but not by the vector alone (pAL). Moreover, heterozygous zygotes (rgf2/rgf2⁺) generated phenotypically wild-type asci, with four viable and refringent ascospores. This result indicates that the rgf2 allele is recessive and suggests that rgf2⁺ expression takes place before the time of prospore enclosure. To pinpoint the exact time at which rgf2⁺ begins to play its role in sporulation, we examined the meiotic time course of rgf2 gene expression by Northern analysis. Synchronous meiosis was induced using the pat1-114 mutation (see MATERIALS AND METHODS). As shown in Figure 1C, rgf2⁺ mRNA was detectable in vegetative cells (at 0 hr) and rgf2⁺ mRNA peaked at 5 hr when cells were in meiosis II, although a certain level of rgf2⁺ mRNA was maintained during spore wall maturation. The rgf2⁺ induction profile was similar to that described by MATA et al. (2002), available on the S. pombe gene database (http://www.genedb.org/genedb/pombe/index.jsp). Taken together, these observations indicate that rgf2⁺ is required for spore development and that its induction profile is that of a late gene whose expression is induced just before the bulk of refringent ascospores appear.

Rgf2p is required for the assembly of functional spore walls:

The induction profile of rgf2⁺ and the fact that RhoGTPases play important roles in the regulation of protein transport and membrane recycling prompted us to test the possibility that the rgf2 mutation might be affecting forespore membrane (FSM) expansion during the early stages of sporulation. To this end, the envelopes of the developing spores were monitored using a GFP-tagged marker protein (Mde10 fused to GFP in plasmid A799) and nuclei stained with the Hoechst DNA-specific fluorophore. We constructed an rgf2 h⁹⁰ (PG9) and the isogenic h⁹⁰ wild-type parental strain (YS260). Both homothallic strains were transformed with plasmid A799, (kindly provided by Y. Hiraoka, Kobe, Japan) (DING et al. 2000; NAKAMURA et al. 2004), cultured in MM (–N) for 10 hr, and stained with Hoechst reagent. Both the first and the second meiotic divisions in the mutants proceeded with similar kinetics to those of wild-type cells (not shown). Moreover, 86% of the rgf2 asci showed four spore-like structures outlined by GFP signals (n = 40 asci labeled with GFP) (Figure 2A). Our results clearly indicate that the rgf2 mutation does not impair meiosis or the normal development of the FSM.

View larger version (64K): In this window In a new window Download PPT slide   FIGURE 2.— Characterization of the phenotype of the rgf2 disruptants in sporulation. (A) Encapsulation of nuclei in rgf2 spores. The homothallic haploid strains YS260 (h90 rgf2+) and PG9 (h90 rgf2) harboring the A799 plasmid were incubated in MM –N and samples were taken after 12 hr. FSM (fore-spore membranes) were visualized by fluorescence (Mde10-GFP) and nuclei by Hoechst staining. In rgf2 cells, >80% of the spore envelope encapsulated a single nucleus (n = 40 sporulated cells). (B) Efficiency of zygotes and ascospore germination in rgf2 homothallic strains. (Left) Strains YS260 (h90 rgf2+) and PG9 (h90 rgf2) were incubated on MEA plates and the zygotes from 2-day sporulation plates were micromanipulated individually (n = 200 of each strain), spotted onto YES plates, and incubated at 28°. For spore survival, cells from 3-day sporulation cultures were resuspended in 1 ml of water to an OD600 of 20, treated with helicase (0.2%) for 12 hr, and diluted with water. The same dilutions of each strain were spread onto YES plates and incubated for 3 days. (Right) The spores treated with helicase as above were stained with Methylene Blue (0.01% in 0.2 M acetate buffer, pH 5). Lysed cells appear dark blue due to staining with the vital dye.

 
In wild-type cells, refringent spore walls were first seen after 12 hr in sporulation medium. In contrast, microscopic examination of rgf2 cells revealed dark cells, suggesting that the mutants were blocked during the assembly of the spore wall: the structure that confers the spore refringence and a high degree of resistance to stressful conditions. This phenotype suggests a delay in ascospore maturation. Even after prolonged incubation in sporulation medium no increase in the number of refringent spores was observed.

We then examined whether the rgf2 mutant diploid was able to give rise to viable ascospores capable of germinating in rich medium. We noted that the rgf2 asci were not dehiscent, which meant that we could not release single ascospores by simple micromanipulation. To ascertain spore survival, we isolated and individually micromanipulated 200 zygotes of each strain onto rich solid medium (YES or YES plus sorbitol). Most of the wild-type zygotes were viable and formed colonies (82%), whereas the rgf2 zygotes largely failed to germinate (18% viability) (Figure 2B). The percentage of germination was similar, regardless of the presence or absence of sorbitol. To test the possibility that the rgf2 spores were impaired in germination because they failed to break the ascal sac, we treated the sporulating cultures with helicase, an enzyme that destroys vegetative cells and releases single ascospores from the ascus. The rgf2 ascospores released after treatment (0.2% helicase, overnight at room temperature) were gray and showed an aberrant morphology, different from that of the wild-type ascospores, which were round and refringent. The plating efficiency of rgf2 spores was <1% as compared to 81% for the wild-type spores (Figure 2B), and it was independent of the presence of sorbitol in the medium. We then examined spore integrity by staining spores with the vital dye Methylene Blue (0.01%, w/v), a dye that only enters dead cells. Figure 2B shows that while most of the wild-type spores were impermeable to the Methylene Blue stain, >95% of the rgf2 spores were stained. These results suggest that ascospore maturation does not proceed properly in the rgf2/rgf2 homozygous zygotes and that these spores probably lacked one or more of the wall layers responsible for spore resistance and refringency.

Glucan synthase activity is diminished in sporulating rgf2 diploids:

We next analyzed whether Rgf2p might be acting as a glucan synthase (GS) regulator during sporulation. First, we examined the effects of rgf2 disruption on GS activity during ascospore development. To synchronize the cells, we obtained diploid rgf2⁺ and rgf2 strains harboring a pat1-114 mutation (PG107 and PG110, respectively). Cells grown in MM without nitrogen were incubated at the restrictive temperature (34°) and portions of the culture were sampled every 2 hr. Between 4 and 8 hr after the induction of sporulation, and coinciding with the appearance of the rgf2⁺ transcript, GS activity increased and reached a maximum at 6 hr. After 10 hr, GS activity declined, with the widespread appearance of mature asci. This activity peak was strongly diminished in the rgf2 diploid strain (Figure 3A, left). This result indicates that Rgf2p is involved in β-glucan biosynthesis during sporulation.

View larger version (72K): In this window In a new window Download PPT slide   FIGURE 3.— Glucan synthase activity is diminished in sporulating rgf2 diploids. (A) In vitro β-GS activity in wt and rgf2 sporulating strains (left). The diploid strains rgf2+ and rgf2 harboring a pat1-114 mutation (PG107 and PG110, respectively) were grown in MM-N and incubated at the restrictive temperature (34°). Then, 100-ml portions of the culture were sampled every 2 hr and assayed for GS activity, starting 4 hr after the temperature shift (see MATERIALS AND METHODS). The values shown are from one experiment, but similar results were obtained in two additional independent experiments. Specific activity is expressed as milliunits/milligrams protein. The final GTP concentration in the assay was 150 µM. Sporulation phenotype of wild type (YS260), bgs2 (MS228), rgf2 (PG9), and rgf2bgs2 (NG188) homothallic haploid strains (right). (B) Localization of Rgf2p during sporulation. (Left) Rgf2p was detected in cells of strain PG260 carrying the chromosomal copy of Rgf2p tagged with GFP and incubated in sporulation medium for 14 hr. The Rgf2p-GFP signal was observed when the spore outline was defined. (Right) Localization of Rgf2p in vegetative cells. Early log-phase cells containing the rgf2+-GFP fusion allele on a plasmid (pGR76) were visualized for GFP fluorescence. Rgf2p localizes to the growing regions: one or both poles and the septum. Bar, 10 µm.

 
We also observed that the rgf2 phenotype, characterized by dark, immature spores, resembled that previously seen in the bgs2 mutants, which are defective for the glucan synthase catalytic subunit (GS) (LIU et al. 2000; MARTÍN et al. 2000). We therefore reasoned that if Rgf2p was acting as a Rho1p-GEF, and was thus activating β-glucan synthesis, the double mutant rgf2bgs2 would be blocked at the same stage as each individual mutant. This can be seen in Figure 3A (right): the rgf2bgs2 homozygous asci are apparently very similar to the individual rgf2 and bgs2 homozygous asci. We have previously shown that the bgs2 phenotype is epistatic to the chs1 phenotype (chitin synthase mutant) (ARELLANO et al. 2000), and to the mok12 phenotype (-glucan synthase mutant) in homozygous diploids, suggesting that β-glucan synthesis occurs within the prospore membrane before the deposition of other layers on the spore surface (MARTÍN et al. 2000; GARCÍA et al. 2006). In a similar approach, we observed that the morphology of the spores from homothallic strains rgf2chs1 (PG280) and rgf2mok12 (PG222) was dark and uniform, very similar to that of the rgf2 spores (data not shown).

To determine the intracellular localization of Rgf2p, the coding sequence of GFP was fused in-frame before the stop codon of rgf2⁺ using a PCR-based approach (BÄHLER et al. 1998). The resulting strain (PG260) contained the fusion under the control of the native rgf2⁺ promoter and the fusion protein was fully functional. As shown in Figure 3B, the fluorescence signal appeared to be localized uniformly at the periphery of the spore, probably associated with the forespore inner membrane. Consistent with the timing of expression of its mRNA, Rgf2-GFP fluorescence appeared in the fraction of cells that had already undergone meiosis I and II, where the spore outline was perfectly defined (see Nomarsky photos). The fluorescence signal was completely absent in vegetative cells grown in rich medium. To ascertain whether the lack of signal might be a consequence of the low expression of Rgf2p-GFP during vegetative growth, we expressed the Rgf2p-GFP on a multicopy plasmid (pAL-rgf2⁺-8ala-GFP). Under these conditions, Rgf2p fluorescence localized to the growing ends, the septum, and also slightly spread out along the cell surface (Figure 3B, right).

rgf2⁺ overexpression elicits an aberrant morphology, promotes the GDP-GTP exchange, and increases β(1,3)-glucan synthase during vegetative growth:

The above results prompted us to investigate whether Rgf2p might play a role as a Rho1p activator during vegetative growth. For these experiments, the rgf2⁺ gene was cloned under the thiamine-repressible nmt1 promoter in the pREP3X vector. Plasmid pREP3X (empty) or pREP3X-rgf2⁺ (overexpressor) were transformed into wild-type cells expressing HA-rho1⁺ from its own promoter. It has been reported that overexpression of rho1⁺ is not lethal but produces swollen and multiseptated cells, with thick walls and thick septa (ARELLANO et al. 1996; NAKANO et al. 1997). Surprisingly, when thiamine was eliminated to enhance rgf2⁺ expression, the cells were unable to produce visible colonies on plates. After 18 hr of induction in liquid culture, the cells were larger than wild-type cells and displayed multiple abnormal septa. These cells also showed a general increase in Calcofluor white (Cfw) fluorescence, most of them containing aberrant depositions of Cfw-stainable material (see cells marked with an arrow in Figure 4A).

View larger version (58K): In this window In a new window Download PPT slide   FIGURE 4.— rgf2+ overproduction (OP) produces aberrant cells and increases β-GS activity. (A) Phenotype of Rgf2p OP. Overexpression of rgf2+ causes cell growth arrest and an abnormal accumulation of cell wall material. Nomarsky and Calcofluor-stained UV micrographs of wild-type cells transformed with pREP3X (empty plasmid), pREP3X-rgf2+ (Rgf2-OP) or pREP3X-rgf2RTTP (Rgf2RTTP-OP) grown without thiamine for 20 hr. Overexpression of the Rgf2-PTTR protein (mutated in the RhoGEF domain) gave rise to wild-type morphology. (B) The level of Rgf2p modulates the amount of GTP-bound Rho1p in vivo. Wild-type cells expressing HA-rho1+ from its own promoter (PPG1.60) were transformed with plasmid pREP3X, pREP3X-rgf2+, or pREP3X-rgf2RTTP as above. GTP-Rho1p was pulled down from the cell extracts with GST-C21RBD and blotted against 12CA5, an anti-HA mAb. (C) In vitro glucan synthase (GS) activity assayed with the membrane fraction of wild-type cells (YS64) transformed with pREP3X (empty plasmid), pREP3X-rgf2 (Rgf2-OP), pREP4X-rho1 (Rho1-OP), or both pREP3X-rgf2 and pREP4X-rho1 (Rgf2-OP and Rho1-OP). Extracts were prepared from cells grown in MM without thiamine at 32° for 18 hr. Specific activity is expressed as milliunits/milligrams protein. Values are means of at least three independent experiments with duplicate samples, and error bars represent standard deviations (SD).

 
Next, we analyzed the in vivo amount of GTP-bound Rho1p in cells overexpressing Rgf2p. After induction of the nmt1 promoter for 20 hr, the amount of Rho1p bound to GTP was precipitated with GST-C21RBD, the rhotekin-binding domain (which had previously been obtained and purified from bacteria), and blotted with anti-HA antibody (Figure 4B). Western blots of whole extracts (25 µg protein) showed that the total amount of Rho1p was similar in all strains. However, the amount of active Rho1p increased considerably in the strain overexpressing Rgf2p as compared with the wild-type strain (Figure 4B). As a control we examined whether the GEF domain was required for the Rgf2p-related overexpression phenotypes. We created a deletion mutant in the RhoGEF domain of Rgf2p (rgf2-PTTR). The four amino acids deleted in the rgf2-PTTR mutant (proline-threonine-threonine-arginine, PTTR) have been predicted to be located on helix H8 (CR3), which is the most highly conserved region of the DH domain and is where many mutations that decrease nucleotide exchange activity map (LIU et al. 1998; SOISSON et al. 1998). We have previously shown that a similar mutation in Rgf1p (rgf1-PTTR mutant) produces a loss-of-function phenotype (GARCÍA et al. 2006a, 2009). As expected, overexpression of the rgf2-PTTR mutant in a pREP3X vector produced viable cells and no multiseptated phenotype was seen, even at very long times of derepresion in the absence of thiamine (Figure 4A). Moreover, overexpression of the mutated version (rgf2-PTTR) did not increase the amount of GTP-Rho1p (active-Rho1p) in a "pull down" binding assay (Figure 4B).

Finally, we analyzed glucan synthase (GS) activity during rgf2⁺ overexpression. GS activity was threefold higher than that observed in the wild-type strain (Figure 4C). To corroborate these results, we also studied the activity in cells overexpressing rho1⁺ and rgf2⁺ at the same time (transformed with pREP4X-rho1 and pREP3X-rgf2 plasmid). As described previously, cells overexpressing rho1⁺ showed an increase in GS activity (Figure 4C) (ARELLANO et al. 1996). This increase was considerably higher (ninefold) in cells that overexpressed rgf2⁺ at the same time (Figure 4C). These results clearly indicate that Rgf2p is involved in the regulation of β(1,3)-glucan biosynthesis.

Synthetic lethality of rgf2::ura4⁺ and rgf1::his3⁺:

We used genetic approaches to ascertain whether Rgf2p showed any functions overlapping with the other Rho1p GEFs, Rgf1p, and Rgf3p. First, we investigated whether rgf1⁺ and rgf2⁺ interacted genetically. After analyzing tetrads of a rgf1::his3⁺ h^– x rgf2::ura⁺ h⁺ cross, we failed to find any double mutant spore (rgf1rgf2). Of 18 asci dissected: 11 yielded one his^– ura^– spore, one his⁺ ura^– spore, one his^– ura⁺, and one unviable spore predicted to be his⁺ ura⁺. Three asci yielded 4 viable parental-type spores, and 2 asci yielded 3 viable parental-type spores. None of the 11 spores predicted to be rgf1::his3⁺ rgf2::ura⁺ was viable, strongly supporting the idea that simultaneous disruption of rgf1⁺ and rgf2⁺ is lethal. To eliminate the possibility that these mutations might be affecting only sporulation or germination, we also tested for synthetic lethality during vegetative growth. We created a strain, P81nmt-rgf1 rgf2 (GRG33), deleted for the rgf2⁺ gene and with the endogenous rgf1⁺ promoter replaced by the P81nmt promoter [P81nmt is a thiamine-regulatable and reduced expression-rate promoter derived from the nmt1 promoter, (FORSBURG 1993)]. As shown in Figure 5A, the cells displayed normal morphology when rgf1⁺ was expressed in the absence of thiamine (promoter on). Six hours after the addition of thiamine to repress rgf1⁺ expression, 68% of the cells had shrunk, and after 9 hr the whole culture had lysed (Figure 5A). The lysis phenotype seen in the P81nmt-rgf1rgf2 double mutant was similar to that observed in the rgf1 mutant, and in cells depleted for Rgf3p or Rho1p. However, while Rho1p depletion causes cell death mainly after cytokinesis, in this case most of the cells lysed as single and long cells, a phenotype characteristic of the rgf1⁺ null mutants and probably related to their NETO defect (ARELLANO et al. 1997; GARCÍA et al. 2006a). The cell death due to Rho1p depletion cannot be prevented by an osmotic stabilizer (ARELLANO et al. 1997) and (Figure 5B), while the same phenotype produced by Rgf3p depletion is prevented by 1.2 M sorbitol (TAJADURA et al. 2004). We therefore examined whether the double mutant P81nmt-rgf1rgf2 shut-off phenotype could be rescued by osmotic support. As shown in Figure 5B, both Rgf1p Rgf2p-depleted, and Rho1p-depleted cells were unable to grow in YES medium (promoter off) regardless of the presence or absence of 1.2 M sorbitol.

View larger version (83K): In this window In a new window Download PPT slide   FIGURE 5.— Double disruption of Rgf1p and Rgf2p is essential for cell viability. (A) Depletion of Rgf1p in an rgf2 background leads to a lysis phenotype similar to depletion of Rho1p. Lethal phenotype of the P81 nmt-rgf1rgf2 (GRG33) and P41 nmt-rho1 (PPG2.17) shut-off mutants. Cells grown at 28° in MM were supplemented with thiamine to repress the nmt promoter. For Rgf1p shut-off, Nomarsky micrographs were taken before and after the addition of thiamine (6 hr and 9 hr). For Rho1p shut-off, the micrographs were taken after 11 hr in MM with thiamine. (B) Strains nmt1-rgf1+ rgf2 (GRG33), nmt1-rgf3+ (VT88), nmt1-rgf3+rgf1 (PG94), ehs2-1 rgf2 (PG105), nmt1-rgf3+rgf2 (PG395), nmt1-rho1+ (PPG2.17), nmt1-rgf1+ (PG115), rgf2 (GRG55) were streaked onto MM (without thiamine), YES and YES plus sorbitol 1.2 M plates and incubated at 28° for 4 days.

 
We also tested whether any other combination between mutations of Rho1p activators might cause cell death. Rgf3p is essential, so we used a strain with a TS mutation in rgf3⁺, the ehs2-1⁺ mutation that stands for "echinocandin-hypersensitive." At 37° in liquid medium the ehs2-1 cells showed a lytic thermosensitive phenotype (TAJADURA et al. 2004). We first created a strain lacking rgf2⁺ with a TS mutation in rgf3⁺ (rgf2, ehs2-1). This strain, PG105, was viable and phenotypically indistinguishable from the ehs2-1 mutant (Figure 5B). In addition, we constructed a strain deleted for rgf2⁺ with the rgf3⁺ gene under the control of the P81nmt promoter P81nmt-rgf3rgf2 (PG395) (MATERIALS AND METHODS). As expected for the rgf3⁺ shut-off, the cells died in the presence of thiamine (promoter off). However, their growth was rescued in the presence of sorbitol (Figure 5B). Finally, we searched for an interaction between Rgf1p and Rgf3p. To this end, we constructed a strain, P81nmt-rgf3rgf1 (PG94), in which the rgf3⁺ gene was under the control of the P81nmt promoter and the rgf1⁺ gene was deleted (see MATERIALS AND METHODS). As above, growth of the P81nmt-rgf3rgf1 strain in rich medium (promoter off) was dependent on the presence of 1.2 M sorbitol (Figure 5B).

Our results indicate that Rgf1p and Rgf2p share an essential role as Rho1p activators, and they suggest that in the absence of Rgf1p, Rgf2p takes over the essential functions for Rho1p during vegetative growth.

Rgf2p behaves as a functional homolog of Rgf1p when expressed during vegetative growth:

We next examined whether the functions of Rgf1p and Rgf2p were interchangeable. Previous studies had shown that the rgf1⁺ deletion causes cell lysis, hypersensitivity to the antifungal drug caspofungin (Csp), and defects in the establishment of bipolar growth (GARCÍA et al. 2006a). We overexpressed rgf2⁺ in an rgf1 background. Figure 6A (top) shows that rgf2⁺ expressed from plasmids, containing the rgf2⁺ genomic promoter (pGR13) or the strongest nmt1 promoter (pGR70), fully rescued the lysis and the Csp hypersensitivity of rgf1 cells in medium containing thiamine. We had previously observed that the overexpression of rgf2⁺ (under the high-strength nmt1 promoter) was lethal by itself in a wild-type background; this is shown in Figure 6A (MM top panel). To avoid this problem, we made use of the rgf2⁺ driven by the P81nmt promoter (low level, pGR72) and the P41Xnmt promoter (medium level, pGR71). Both constructs produced viable cells (in the absence of thiamine: promoter on), and complementation of the hypersensitivity to Csp was found even in the presence of thiamine (promoter off) (Figure 6A, bottom). We therefore wondered whether rgf2⁺ would be able to rescue the monopolar-to-bipolar switch defect in the rgf1 mutants. To address this, we transformed rgf2⁺ expressed from its own promoter (pGR13) or the empty plasmid (pAL) in the double mutant cdc10-129 rgf1 and synchronized cells in G1 by arrest at 37°. Strain cdc10-129 rgf1⁺ was used as a wild-type control of proper bipolar growth and it was also transformed with plasmid pGR13. The areas in which new cell wall deposition, and hence growth, was occurring were visualized using the fluorescent dye Calcofluor white (Cfw). Ninety minutes after being shifted to the permissive temperature of 25°, 47% of cdc10-129rgf1 cells overexpressing rgf2⁺ were bipolar, whereas only 10% were observed in the cdc10-129 rgf1 cells bearing the empty plasmid (Figure 6B). Thus, mild overexpression of rgf2⁺ was able to suppress the bipolar growth defect of rgf1 mutants.

View larger version (50K): In this window In a new window Download PPT slide   FIGURE 6.— The caspofungin–hypersensitive growth phenotype of rgf1 mutants is suppressed by overexpresion of rgf2+. (A) rgf1 (VT14) was transformed with pREP3X (empty vector), pREP3X-rgf2+ (pGR70), pAL-rgf2+ (pGR13), pREP81X-rgf2+ (pGR72), and pREP41X-rgf2+ (pGR71). Transformants were spotted onto MM, MM plus thiamine and MM plus thiamine and 1.5 µg/ml of caspofungin plates as serial dilutions (8 x 104 cells in the left row, and then 4 x 104, 2 x 104, 2 x 103, 2 x 102, and 2 x 101 in each subsequent spot) and incubated at 28° for 3 days. (B) cdc10-129 rgf1 (PG88) transformed with pAL (control) and pAL-rgf2+, and cdc10-129 (MS168) transformed with plasmid pAL-rgf2+ were grown at 25° to OD600 0.15, shifted to 37° for 4 hr, and then grown at 25° for 150 min. Aliquots of cells were harvested before and every 30 min after the shift to 25°. The graphic (on the right) represents the percentages of bipolar cells at each time point. Micrographs show Cfw-stained cdc10-129 rgf1 plus empty plasmid (pAL) and pAL-rgf2+ at 90 min after the shift to 25°. (C) Rgf1p partially complemented the sporulation defect seen in the rgf2 mutants. The homothallic haploid strain PG9 (h90 rgf2) transformed with different plasmids, empty (pAL), pAL-rgf2+, pALrgf1+, and pAL-Prgf2-rgf1+, and the YS260 (h90) strain carrying the empty plasmid pAL were incubated on MEA plates. After 4 days, spores were resuspended in 1 ml of water to the same OD600 20, treated with helicase (0.2%) for 12 hr, and diluted in water. The same dilutions of each strain were spread onto YES plates and incubated for 3 days. In the experiment, the spore survival of each strain was the average of three platings. The experiment was repeated at least three times.

 
Consistent with the hypothesis that Rgf1p and Rgf2p are able to substitute for each other during vegetative growth, we found that the expression of rgf1⁺ driven by the rgf2⁺ promoter on a multicopy plasmid partially complemented the sporulation defect of an rgf2 h⁹⁰ strain (PG9) (22% ascopore survival compared with the 1% of survival with the empty plasmid) (Figure 6C). This complementation was most likely dependent on the expression of rgf1⁺ during sporulation, since we failed to observe complementation when rgf1⁺ was driven by its own promoter (Figure 6C).

GEFs are directly responsible for the activation of Rho-family GTPases in response to diverse stimuli, and ultimately they regulate many cellular responses, such as proliferation, differentiation, and movement (ROSSMAN et al. 2005a). In fission yeast there are seven proteins with a Rho-GEF domain: scd1⁺, gef1⁺, gef2⁺, gef3⁺, rgf1⁺, rgf2⁺, and rgf3⁺ (http://www.genedb.org/genedb/pombe/index.jsp) (IWAKI et al. 2003). Of these, scd1⁺ and gef1⁺ are Cdc42p-specific GEFs, and Rgf3p and Rgf1p have been described as GEFs for Rho1p, while gef2⁺ and gef3⁺ have not yet been assigned to any known GTPase (GARCÍA et al. 2006b). Considering that there are four additional Rho GTPases and at least two biochemically uncharacterized GEFs, it will take considerable effort in the future to sort out the biochemical specificities, cellular roles, and regulation of each Rho-GEF. Our data provide new evidence to show that Rgf2p acts as an exchange factor for Rho1p and that this activity is necessary for the development of the ascospore wall.

Deletion of rgf2⁺ blocks spore-wall development:

Sexual reproduction proceeds through mating and meiosis, and it culminates with the formation of ascospores, which in itself is a process of differentiation into a specialized cell form. Spores are metabolically inert and tolerant to severe environmental stresses. One of the most intriguing aspects of this process is the de novo synthesis of a plasma membrane and cell wall. During mitotic cell division, the plasma membrane of the mother cell is inherited by the two daughter cells and cell wall synthesis therefore extends from an old cell-wall precursor. By contrast, sporulation requires the de novo establishment of wall-producing plasma membranes within the mother cell cytoplasm, and the cell wall materials accumulate, without precursor, in the lumen of these membranes (EGEL 2004; SHIMODA and NAKAMURA 2004).

Here we show that Rgf2p is required for proper spore wall formation and that it is involved in spore maturation. First, no mature or refractile spores were formed in rgf2 homozygous asci after incubation in sporulation medium for several days. The appearance of the mutant spores was always very similar, suggesting they arrest at a particular stage of development. This phenotype was almost identical to that seen in spores lacking bgs2⁺, the sporulation-specific GS catalytic subunit, and this observation suggests that both proteins function in the same process. As described previously for bgs2 asci, rgf2 asci were able to complete meiosis I and meiosis II, and each of the spores was bounded by a forespore membrane, thus indicating that early events in spore morphogenesis were normal. Moreover, the localization of the -glucan synthases Mok12-GFPp and Mok13-GFPp to the four nuclear envelopes was similar in rgf2 and wild-type cells (not shown).

Second, rgf2 zygotes were not able to release ascospores spontaneously, and only 18% of the zygotes gave rise to colonies as compared to the 83% survival of the wild-type zygotes. When the ascospores were released from the ascal sac by mild treatment with helicase (0.2%), only 1% of the rgf2 spores survived, indicating that they were unable to assemble a functional spore wall. These results suggest that the spore wall is not only the cellular structure responsible for the extreme resistance to stress conditions but that proper assembly of the spore wall is itself important for spore survival. Third, rgf2⁺ expression was induced 15-fold (MATA et al. 2002) after the second meiotic division (at 5 hr) and the transcript was maintained until mature spores appeared between 10 and 12 hr. Rgf2p tagged with GFP localized to structures around each of the four nuclear lobes and appeared when the spore outline was visible under phase contrast microscopy.

The coincidence of the expression of rgf2⁺ with the synthesis of the spore wall, the fact that Rgf2p has been proposed as a GEF for Rho1p on the basis of two-hybrid analysis (MUTOH et al. 2005), together with the phenotypes described above, all suggest that the rgf2⁺ gene is directly involved in β-1,3-glucan synthesis. We observed that mutation of the rgf2⁺ gene resulted in a 2.5 reduction in β-GS activity that peaked at 6 hr in synchronous sporulation cultures. Moreover, Rgf2p overproduction in vegetative cells raised the amount of Rho1p bound to GTP and elicited a phenotype similar to that of the constitutively active allele Rho1G15V in wild-type S. pombe cells, providing confirmatory results for the hypothesis that Rgf2p indeed activates β-glucan during sporulation. It is likely that β-glucan synthesis would occur within the prospore membrane before the deposition of other layers on the spore surface, such as -glucans or chitin-like material. In agreement with this, we observed that the rgf2 phenotype was epistatic to the mok12 (the -GS sporulation specific) or the chs1 (the chitin-synthase sporulation-specific) phenotype in rgf2mok12 or rgf2chs1 double mutants, respectively. Taken together, all these results indicate that Rgf2p functions in sporulation, when the assembly and maturation of the spore wall occurs.

Role of rgf2⁺ in vegetative growth:

Rgf1p and Rgf2p are the closest related members among the GEF family in S. pombe. Both proteins share the same domain structure and 63% identity within the DH domain (Dbl homology domain). This is very unusual, since DH domains, also called "Rho GEF domains," generally share little sequence identity with each other. In S. pombe, the percentage of identity between the deduced amino acid sequence of the DH domain that belongs to GEFs with the same substrate specificity was <20% between Rgf1p and Rgf3p, and Scd1p and Gef1p, respectively. Despite this, crystallographic and NMR analyses of several DH domains have revealed a highly related three-dimensional structure (SCHMIDT and HALL 2002).

Previous studies have shown that Rho1p depletion causes cell death concomitant with a decrease in β-1,3-GS activity, and that the lysis in these conditions cannot be prevented by an osmotic stabilizer (ARELLANO et al. 1997). Among the Rho1p GEFs described to date, only Rgf3p is essential for cell survival. However, the Rgf3p shut-off was rescued by the presence of sorbitol, suggesting that in the presence of an osmotic support Rho1p may be activated by other GEFs (TAJADURA et al. 2004).

MUTOH et al. (2005) reported that double deletion of rgf1⁺ and rgf2⁺ is synthetically lethal and our work has shown that the lysis-and-death phenotype seen in Rgf1p- and Rgf2p-depleted vegetative cells is not prevented by sorbitol. These results strongly suggest that both proteins have an essentially overlapping function, probably as Rho1p activators. This genetic interaction is specific to Rgf1p and Rgf2p, since we observed that other mutant combinations were not essential for survival. Cells depleted for Rgf1p and Rgf3p, or Rgf3p and Rgf2p at the same time were able to survive in the presence of sorbitol. Moreover, Rgf1p and Rgf3p were not functionally interchangeable. Moderate expression of rgf1⁺ did not suppress lysis at 37° of the rgf3 mutant (ehs2-1), and the rgf3⁺ gene driven either by its own promoter or by the nmt1 promoter was not able to suppress the hypersensitivity to the presence of caspofungin or the lysis of rgf1 cells (TAJADURA et al. 2004).

We also found that Rgf2p appears to be fully competent to substitute for Rgf1p, when expressed at a high enough level. Rgf2p fully suppressed the caspofungin-hypersensitive phenotype and, to a lesser extent, bipolar growth activation in rgf1 mutants. On the other hand, the sporulation defect of rgf2 was not complemented by extra copies of rgf1⁺. Rgf1p is probably poorly expressed during sporulation, but the sporulation defect seen in the rgf2 mutants was partially suppressed when rgf1⁺ was driven by the rgf2⁺ promoter. These results imply that, if expressed, Rgf1p can functionally replace Rgf2p in the synthesis of spore wall glucan. Interestingly, while bgs2 mutants (affected in the β-GS catalytic subunit) were completely defective in spore germination (MARTÍN et al. 2000), 5% of rgf2 spores germinated (without helicase treatment), suggesting that the redundancy among Rgf1p and Rgf2p could account for Rho1p activation during sporulation. Together, these results further suggest that Rgf1p and Rgf2p may be alternative GEFs with overlapping functions.

Biochemical data also support this view. It has been shown that Rgf1p acts as a Rho1p GEF; both proteins coimmunoprecipitate and overexpression of rgf1⁺ increases the GTP-bound Rho1p and causes a large increase in β-1,3-GS activity (GARCÍA et al. 2006a). We observed that the overexpression of Rgf2p in vegetative cells behaved in the same way, increasing the level of GTP-Rho1p in vivo and β-1,3-GS activity, which was threefold higher than that of the wild-type cells. Moreover, the overexpression of rgf2⁺ was lethal and produced long, multiseptated and highly refringent cells, with a phenotype similar to that of the constitutively active allele Rho1G15V or the overexpression of rgf1⁺.

Differential expression of rgf1⁺ and rgf2⁺:

Since Rgf1p and Rgf2p seem to activate the synthesis of β-glucan at different points of the yeast cycle, it is interesting to note that their regulation often appears to follow opposite trends: when the level of one is high, that of the other is low. Data from our lab and others suggest that both genes are differentially expressed (MATA et al. 2002; MUTOH et al. 2005; GARCÍA et al. 2006a). For Rgf1p, the mRNA level is constant along the cell cycle (our unpublished results), but protein localization has been shown to be regulated in a cell-cycle-dependent manner, moving from the old end to the new end and then back to the septum during cytokinesis (GARCÍA et al. 2006a). For Rgf2p, the rgf2⁺ mRNA was highly induced in sporulation (after meiosis II), while it showed a low profile in vegetative cells. Accordingly, the Rgf2 protein tagged with GFP was hardly seen in vegetative wild-type cells. Only the mild overexpression of Rgf2p in a multicopy plasmid with its own promoter revealed weak fluorescence in the areas of growth and across the whole cell surface.

The differential expression observed may also account for the fact that the redundancy of Rgf1p and Rgf2p appears to be partial in both directions. Disruption of rgf1⁺ results in a slow growth pattern at 28°, and the viability of the rgf1 cells was 55% as compared to that of the wild-type isogenic strain (GARCÍA et al. 2006a). Thus, rgf2⁺ only partially compensates for the lack of rgf1⁺ during vegetative growth. In the absence of rgf2⁺, only 5% of the spores were able to germinate under laboratory conditions. In this sense, rgf1⁺ only partially compensated for the absence of rgf2⁺ in sporulation.

Many questions, however, still remain unanswered. Are Rgf1p or Rgf2p involved in the synthesis of the same type of β-glucan or in that of a slightly different type of β-glucan? Are GEFs only important for the temporal or spatial activation of Rho1p, acting independently of the catalytic subunits? Rgf2p is specifically involved in β-glucan biosynthesis during sporulation, probably doing its job in the local activation of Rho1p/Bgs2p. If Rgf2p function during vegetative growth is exclusively related to Rho1p/Bgs2p activation, then the double mutation in rgf1⁺ and bgs2⁺ should be synthetically lethal. We observed that rgf1bgs2 mutant cells behaved like the rgf1 mutants as regards sensitivity to caspofungin and lysis. However, they were thermosensitive for growth while none of the individual mutants were. The results thus suggest that Rgf2p might be activating Rho1p, but that it does not function exclusively through Bgs2p to cope with stress situations during polarized growth.

In conclusion, the differences in the phenotypes caused by the deletion of rgf1⁺ and rgf2⁺ and the differences in the regulation of these genes suggest that these two GEFs have different functions within the cell.

We thank S. Moreno and P. Perez for strains. C. Roncero and H. Valdivieso are acknowledged for their very helpful comments. P.G. and I.G. were supported by a fellowship from the Junta de Castilla y León. G.R. was supported by a fellowship from the Basque government. Text was revised by N. Skinner. This work was supported by grants BFU2005-01557 and BFU2008-00963 from the Comisión Interministerial de Ciencia y Tecnología, Spain and SA008A07 and GR231 from the Junta de Castilla y León.

¹ Present address: Departamento de Biología Funcional, Universidad de Oviedo, 33006 Oviedo, Spain.

² Present address: Servicio de Inmunología Clínica, Hospital Clínico San Carlos, 28040 Madrid, Spain.

ARELLANO, M., H. CARTAGENA-LIROLA, M. A. NASSER HAJIBAGHERI, A. DURÁN and M. H. VALDIVIESO, 2000 Proper ascospore maturation requires the chs1⁺ chitin synthase gene in Schizosaccharomyces pombe. Mol. Microbiol. 35: 79–89.[CrossRef][Medline]

ARELLANO, M., A. DURÁN and P. PÉREZ, 1996 Rho1 GTPase activates the (1–3)β-D-glucan synthase and is involved in Schizosaccharomyces pombe morphogenesis. EMBO J. 15: 4584–4591.[Medline]

ARELLANO, M., A. DURÁN and P. PÉREZ, 1997 Localization of the Schizosaccharomyces pombe Rho1 GTPase and its involvement in the organization of the actin cytoskeleton. J. Cell Sci. 110: 2547–2555.[Abstract]

BÄHLER, J., J.-Q. WU, M. S. LONGTINE, N. G. SHAH, A. MCKENZIE, III et al., 1998 Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14: 943–951.[CrossRef][Medline]

BOS, J. L., H. REHMANN and A. WITTINGHOFER, 2007 GEFs and GAPs: critical elements in the control of small G proteins. Cell 129: 865–877.[CrossRef][Medline]

CALONGE, T. M., M. ARELLANO, P. M. COLL and P. PÉREZ, 2003 Rga5p is a specific Rho1p GTPase-activating protein that regulates cell integrity in Schizosaccharomyces pombe. Mol. Microbiol. 47: 507–518.[CrossRef][Medline]

CORTÉS, J. C., E. CARNERO, J. ISHIGURO, Y. SÁNCHEZ, A. DURÁN et al., 2005 The novel (1,3)β-D-glucan synthase catalytic subunit Bgs4p from fission yeast is essential during both cytokinesis and polarized growth. J. Cell Sci. 118: 157–174.[Abstract/Free Full Text]

CORTÉS, J. C., M. KONOMI, I. M. MARTINS, J. MUÑOZ, M. B. MORENO et al., 2007 The (1,3)beta-D-glucan synthase subunit Bgs1p is responsible for the fission yeast primary septum formation. Mol. Microbiol. 65: 201–217.[CrossRef][Medline]

CRAVEN, R. A., D. J. GRIFFITHS, K. S. SHELDRICK, R. E. RANDALL, I. M. HAGAN et al., 1998 Vectors for the expression of tagged proteins in Schizosaccharomyces pombe. Gene 221: 59–68.[CrossRef][Medline]

CHEN, S., and H. E. HAMM, 2006 DEP domains. More than just membrane anchors. Dev. Cell 11: 436–438.[CrossRef][Medline]

DING, D. Q., Y. TOMITA, A. YAMAMOTO, Y. CHIKASHIGE, T. HARAGUCHI et al., 2000 Large-scale screening of intracellular protein localization in living fission yeast cells by the use of a GFP-fusion genomic DNA library. Genes Cells 5: 169–190.[Abstract]

DURÁN, A., and P. PÉREZ, 2004 Cell wall synthesis, pp. 269–276 in The Molecular Biology of Schizosaccharomyces pombe. Genetics, Genomics and Beyond, edited by R. EGEL. Springer-Verlag, Berlin.

EGEL, R., 2004 Fission yeast in general genetics, pp. 1–10 in The Molecular Biology of Schizosaccharomyces pombe. Genetics, Genomics and Beyond, edited by R. EGEL. Springer-Verlag, Berlin.

FORSBURG, S. L., 1993 Comparison of Schizosaccharomyces pombe expression systems. Nucleic Acids Res. 21: 2955–2956.[Free Full Text]

GARCÍA, I., V. MARTÍN, V. TAJADURA, T. TODA and Y. SÁNCHEZ, 2006 Synthesis of -glucans in fission yeast spores is carried out by three alpha-glucan synthase paralogs, Mok12p, Mok13p and Mok14p. Mol. Microbiol. 59: 836–853.[CrossRef][Medline]

GARCÍA, P., V. TAJADURA, I. GARCÍA and Y. SÁNCHEZ, 2006a Rgf1p is a specific Rho1-GEF that coordinates cell polarization with cell wall biogenesis in fission yeast. Mol. Biol. Cell 17: 1620–1631.[Abstract/Free Full Text]

GARCÍA, P., V. TAJADURA, I. GARCÍA and Y. SÁNCHEZ, 2006b Role of Rho GTPses and Rho-GEFs in the regulation of cell shape and integrity in fission yeast. Yeast 23: 1031–1043.[CrossRef][Medline]

GARCÍA, P., V. TAJADURA and Y. SÁNCHEZ, 2009 The Rho1p exchange factor Rgf1p signals upstream from the Pmk1 mitogen-activated protein kinase pathway in fission yeast. Mol. Biol. Cell 20: 721–731.[Abstract/Free Full Text]

HAYLES, J. A., and P. NURSE, 2001 A journey into space. Nat. Rev. Mol. Cell Biol. 2: 647–656.[CrossRef][Medline]

HUMBEL, B. M., M. KONOMI, T. TAKAGI, N. KAMASAWA, S. A. ISHIJIMA et al., 2001 In situ localization of b-glucans in the cell wall of Schizosaccharomyces pombe. Yeast 18: 433–444.[CrossRef][Medline]

IINO, Y., Y. HIRAMINE and M. YAMAMOTO, 1995 The role of cdc2 and other genes in meiosis in Schizosaccharomyces pombe. Genetics 4: 1235–1245.

IWAKI, N., K. KARATSU and M. MIYAMOTO, 2003 Role of guanine nucleotide exchange factors for Rho family GTPases in the regulation of cell morphology and actin cytoskeleton in fission yeast. Biochem. Biophys. Res. Commun. 312: 414–420.[CrossRef][Medline]

LATGÉ, J. P., 2007 The cell wall: a carbohydrate armour for the fungal cell. Mol. Microbiol. 66: 279–290.[CrossRef][Medline]

LE GOFF, X., A. WOOLLARD and V. SIMANIS, 1999 Analysis of the cps1 gene provides evidence for a septation checkpoint in Schizosaccharomyces pombe. Mol. Gen. Genet. 262: 163–172.[CrossRef][Medline]

LEVIN, D., 2005 Cell wall integrity signaling in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 69: 262–291.[Abstract/Free Full Text]

LIU, X., H. WANG, M. EBERSTADT, A. SCHNUCHEL, E. T. OLEJNICZAK et al., 1998 NMR structure and mutagenesis of the N-terminal Dbl homology domain of the nucleotide exchange factor Trio. Cell 95: 269–277.[CrossRef][Medline]

LIU, J., X. TANG, H. WANG and M. K. BALASUBRAMANIAN, 2000a Bgs2p, a 1,3-β-glucan synthase subunit is essential for maturation of ascospore wall in Schizosaccharomyces pombe. FEBS Lett. 478: 105–108.[CrossRef][Medline]

LIU, J., H. WANG and M. K. BALASUBRAMANIAN, 2000b A checkpoint that monitors cytokinesis in Schizosaccharomyces pombe. J. Cell Sci. 113: 1223–1230.[Abstract]

LIU, J., X. TANG, H. WANG, S. OLIFERENKO and M. K. BALASUBRAMANIAN, 2002 The localization of the integral membrane protein Cps1p to the cell division site is dependent on the actomyosin ring and the septation-inducing network in Schizosaccharomyces pombe. Mol. Biol. Cell 13: 989–1000.[Abstract/Free Full Text]

MANNERS, D. J., and M. T. MEYER, 1977 The molecular structures of some glucans from the cell wall of S. pombe. Carbohyd. Res. 57: 189–203.[CrossRef]

MARTÍN, V., J. C. RIBAS, E. CARNERO, A. DURÁN and Y. SÁNCHEZ, 2000 Bgs2⁺, a sporulation-specific glucan synthase homologue is required for proper ascospore wall maturation in fission yeast. Mol. Microbiol. 38: 308–321.[CrossRef][Medline]

MARTÍN, V., B. GARCÍA, E. CARNERO, A. DURÁN and Y. SÁNCHEZ, 2003 Bgs3p, a putative 1,3-β-glucan synthase subunit, is required for cell wall assembly in Schizosaccharomyces pombe. Eukaryot. Cell 2: 159–169.[Abstract/Free Full Text]

MATA, J., R. LYNE, G. BURNS and J. BAHLER, 2002 The transcriptional program of meiosis and sporulation in fission yeast. Nat. Genet. 32(1): 143–147.[CrossRef][Medline]

MORENO, S., A. KLAR and P. NURSE, 1991 Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194: 795–823.[Medline]

MORRELL-FALVEY, J. L., L. REN, A. FEOKTISTOVA, G. D. HAESE and K. L. GOULD, 2005 Cell wall remodeling at the fission yeast cell division site requires the Rho-GEF Rgf3p. J. Cell Sci. 118: 5563–5573.[Abstract/Free Full Text]

MUTOH, T., K. NAKANO and I. MABUCHI, 2005 Rho1-GEFs Rgf1 and Rgf2 re involved in formation of cell wall and septum, while Rgf3 is involved in cytokinesis in fission yeast. Genes Cells 10: 1189–1202.[Abstract/Free Full Text]

NAKAMURA, T., H. ABE, A. HIRATA and C. SHIMODA, 2004 ADAM family protein Mde10 is essential for development of spore envelopes in the fission yeast Schizosaccharomyces pombe. Eukaryot. Cell 3: 27–39.[Abstract/Free Full Text]

NAKANO, K., R. ARAI and I. MABUCHI, 1997 The small GTP binding protein Rho1 is a multifunctional protein that regulates actin localization, cell polarity, and septum formation in the fission yeast Schizosaccharomyces pombe. Genes Cells 2: 679–694.[Abstract]

NAKANO, K., T. MUTOH and I. MABUCHI, 2001 Characterization of GTPase-activating proteins for the function of the Rho-family small GTPases in the fission yeast Schizosaccharomyces pombe. Genes Cells 6: 1031–1042.[Abstract]

OSUMI, M., N. YAMADA, H. KOBORI, A. TAKI, N. NAITO et al., 1989 Cell wall formation in regenerating protoplast of Schizosaccharomyces pombe: study by high resolution, low voltage scanning electron microscopy. J. Electron Microsc. 38: 457–468.[Abstract/Free Full Text]

REID, T., T. FURIYASHIKI, T. ISHIZAKI, G. WATANABE, N. WATANABE et al., 1996 Rhotekin, a new putative target for Rho bearing homology to a serine/threonine kinase, PKN, and rhophilin in the rho-binding domain. J. Biol. Chem. 271: 13556–13560.[Abstract/Free Full Text]

REN, X. D., W. B. KIOSSES and M. A. SCHWARTZ, 1999 Regulation of the small GTP-binding protein Rho by cell adhesion and the cytoskeleton. EMBO J. 18: 578–585.[CrossRef][Medline]

ROSSMAN, K. L., J. D. CHANNING and J. SONDEK, 2005a GEF means go: turning on Rho GTPases with guanine nucleotide-exchange factors. Nat. Rev. Mol. Cell Biol. 6: 167–180.[CrossRef][Medline]

ROSSMAN, K. L., and J. SONDEK, 2005b Larger than Dbl: new structural insights into RhoA activation. Trends Biochem. Sci. 30: 163–165.[CrossRef][Medline]

SCHMIDT, A., and A. HALL, 2002 Guanine nucleotide exchange factors for Rho GTPases: turning on the switch. Genes Dev. 16: 1587–1609.[Free Full Text]

SHIMODA, C., and T. NAKAMURA, 2004 Control of late meiosis and ascospore formation, pp. 311–325 in The Molecular Biology of Schizosaccharomyces pombe. Genetics, Genomics and Beyond, edited by R. EGEL. Springer-Verlag, Berlin.

SOISSON, S. M., A. S. NIMNUAL, M. UY, D. BAR-SAGI and J. KURIYAN, 1998 Crystal structure of the Dbl and pleckstrin homology domains from the human son of sevenless protein. Cell 95: 259–268.[CrossRef][Medline]

TAIRA, K., M. UMIKAWA, K. TAKEI, B.-E. MYAGMAR, M. SHINZATO et al., 2004 The Traf2- and Nck-interacting kinase as a putative effector of Rap2 to regulate actin cytoskeleton. J. Biol. Chem. 279: 49488–49496.[Abstract/Free Full Text]

TAJADURA, V., B. GARCÍA, I. GARCÍA, P. GARCÍA and Y. SÁNCHEZ, 2004 Schizosaccharomyces pombe Rgf3p is a specific Rho1 GEF that regulates cell wall β-glucan biosynthesis through the GTPase Rho1p. J. Cell Sci. 117: 6163–6174.[Abstract/Free Full Text]

YAMAMOTO, M., 2004 Initiation of meiosis, pp. 297–309 in The Molecular Biology of Schizosaccharomyces pombe. Genetics, Genomics and Beyond, edited by R. EGEL. Springer-Verlag, Berlin.

YANG, P., Y. QYANG, G. BARTHOLOMEUSZ, Z. ZHOU and S. MARCUS, 2003 The novel Rho1 GTPase-activating protein family, Rga8, provides a potential link between cdc42/p21-activated kinase and Rho signaling pathways in the fission yeast, Schizosaccharomyces pombe. J. Biol. Chem. 278: 48821–48830.[Abstract/Free Full Text]

Communicating editor: J. ENGEBRECHT

International Access Link

Online ISSN: 1943-2361  Print ISSN: 0016-6731
Copyright 2009 by the Genetics Society of America
phone: 412-268-1812   fax: 412-268-1813   email: genetics-gsa{at}andrew.cmu.edu