The gon-2 gene of Caenorhabditis elegans encodes a TRPM cation channel required for gonadal cell divisions. In this article, we demonstrate that the gonadogenesis defects of gon-2 loss-of-function mutants (including a null allele) can be suppressed by gain-of-function mutations in the gem-1 (gon-2 extragenic modifier) locus. gem-1 encodes a multipass transmembrane protein that is similar to SLC16 family monocarboxylate transporters. Inactivation of gem-1 enhances the gonadogenesis defects of gon-2 hypomorphic mutations, suggesting that these two genes probably act in parallel to promote gonadal cell divisions. GEM-1::GFP is expressed within the gonadal precursor cells and localizes to the plasma membrane. Therefore, we propose that GEM-1 acts in parallel to the GON-2 channel to promote cation uptake within the developing gonad.

---

IN Caenorhabditis elegans, the efficient uptake of Mg²⁺ by the intestinal epithelial cells is dependent on the activities of gon-2 and gtl-1 (TERAMOTO et al. 2005). Each of these genes encodes a member of the TRPM family of cation channels and the function of either is sufficient to permit growth under conditions of low-level Mg²⁺ supplementation. In humans, the orthologous proteins TRPM6 and TRPM7 are required for efficient uptake of Mg²⁺ by the intestinal epithelial cells (SCHLINGMANN et al. 2002, 2007; WALDER et al. 2002).

gon-2 is also required for the efficient initiation of postembryonic divisions by the gonadal precursors (SUN and LAMBIE 1997). Like other TRPM channels (NADLER et al. 2001; RUNNELS et al. 2001; MONTEILH-ZOLLER et al. 2003), GON-2 is permeable to various cations, including Ca²⁺and Ni²⁺, in addition to Mg²⁺ (TERAMOTO et al. 2005; XING et al. 2008). Our working model is that GON-2 is expressed within the somatic gonadal precursors, where its key function is to mediate the uptake of Mg²⁺, which would then interact with multiple effectors to promote cell growth and cell cycle progression, eventually leading to cell division (WOLF et al. 2008).

The results of our previous genetic characterization of gon-2(lf) mutants indicated that a weak residual activity is still present, even with the strongest loss-of-function alleles (SUN and LAMBIE 1997). Specifically, the penetrance of gonadogenesis failure in gon-2(lf) mutants is <100%. Two nonexclusive possibilities could account for this result. First, since the alleles of gon-2 that we have characterized do not completely eliminate gene function (SUN and LAMBIE 1997), it could be that this low level of GON-2 channel activity is sufficient to support a low level of gonad development. Second, it could be that an alternative, albeit inefficient, mechanism exists that performs cation uptake in parallel to GON-2. Parallel uptake mechanisms for Mg²⁺ have been well documented in prokaryotes; CorA protein typically serves as the primary Mg²⁺ transporter, while MgtA/B and MgtE provide alternative pathways (MAGUIRE 2006). In mammals, five different types of transporter proteins that could potentially mediate Mg²⁺ uptake in parallel to TRPM6/7 have been described: SLC41 (GOYTAIN and QUAMME 2005b; SAHNI et al. 2007; KOLISEK et al. 2008), MagT1 (GOYTAIN and QUAMME 2005c), ACDP (GOYTAIN and QUAMME 2005a), NIPA (GOYTAIN et al. 2007, 2008a), and HIP14 (GOYTAIN et al. 2008b).

In this article, we describe the identification and characterization of the gem-1 locus (gon-2 extragenic modifier). gem-1 encodes a multipass transmembrane protein related to the SLC16 family of solute carrier proteins. We have identified multiple hypermorphic gain-of-function alleles of gem-1, each of which efficiently bypasses the requirement for GON-2 function during gonad development. Although the inactivation of gem-1 alone does not impair the initiation of gonadogenesis, simultaneous inactivation of gem-1 and gon-2 results in nearly complete failure of gonadal cell divisions. Therefore, our results indicate that GEM-1 acts in parallel to GON-2, possibly by functioning as part of an alternative cation uptake system.

Nematode culture and genetics:

C. elegans stocks were grown on NGM-lite plates (SUN and LAMBIE 1997) using AMA1004 as a food source (CASADABAN et al. 1983). Standard methods were used to generate and verify genetic stocks (HODGKIN 1997). Where appropriate, PCR was used to verify ambiguous genotypes. C. elegans var. Bristol (N2) (BRENNER 1974) was used as the genetic background for all experiments except the SNP mapping procedure, which also involved the wild-type strain CB4856 (WICKS et al. 2001). The following mutations and rearrangements were used in this study: LGI—unc-29(e1072), gon-2(q388), and gon-2(ok465); LGIII—dpy-17(e164); LGIV—him-8(e1489); LGV—mIs10[myo-2::gfp pes-10::gfp] (K. LIU and A. FIRE, unpublished results); and LGX—unc-9(e101), unc-84(e1410), and unc-3(e151). The attached duplication, mnDp10(X;I), was used for dosage experiments. For additional details on alleles, see http://www.wormbase.org.

RNA interference (RNAi) feeding was performed as described by TIMMONS et al. (2001). In some experiments, 0.2% lactose was used instead of isopropyl-β--thiogalactopyranoside because it was found to be equally effective.

Molecular biology:

Standard methods were used for PCR amplification, cDNA synthesis, plasmid construction, and DNA sequencing. Unless otherwise noted, molecular biology reagents were obtained from New England Biolabs. RNA for RNAi experiments was synthesized using T7 RNA polymerase (Megascript, Ambion) with either PCR products or purified plasmid clones from the Ahringer RNAi feeding library as template (FRASER et al. 2000; KAMATH et al. 2003). Clones from the Ahringer library were sequenced to confirm insert identity.

Mapping gem-1:

Through standard linkage mapping, we determined that dx66 maps to the right arm of the X chromosome near unc-84 (Figure 1). Next, we used SNP mapping to determine that dx66 is located to the left of polymorphisms within cosmids, H06A10, F02D10, and F02C12. Only 1/8 recombination events between dx66 and unc-84 occurred between dx66 and the SNP within F02C12, which is situated at the far left end of the cosmid clone. This suggested that gem-1 is near, and to the left of, F02C12. Next, we used SNP mapping to assess the location of dx66 relative to unc-9 and F02C12. We found that 7/7 recombination events between unc-9 and dx66 occurred between unc-9 and the left end of F02C12. This placed gem-1 to the right of unc-9 and further supported the idea that it is situated to the left of F02C12, probably on cosmid C49F8. This region contains fewer than six genes, so we proceeded to test these by RNAi, as described in the RESULTS.

View larger version (13K): In this window In a new window Download PPT slide   FIGURE 1.— Map position of gem-1. (Top) The portion of the X chromosome near the gem-1 locus. Map positions are from the genetic map of C. elegans [J. HODGKIN and S. MARTINELLI, personal communication; WormBase (http://www.wormbase.org, release WS192, 7/25/2008)]. Cosmids are indicated below the genetic map; positions are based on WormBase (http://www.wormbase.org). (Bottom) The intron/exon structure of the gem-1 locus. We determined by RT–PCR that the 5'-end of the gem-1 cDNA begins with the SL1 trans-spliced leader sequence, GGTTTAATTACCCAAGTTTGAG, followed by the untranslated sequence, AAGTATCAAGTTATCA. The gem-1 transcript has nine exons, with polyadenylation site(s), ATTAAATTAAATATTCAATATTT, 692 nucleotides downstream of the stop codon. The region deleted by bc364 is indicated. bc364 is flanked by the sequences AATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAG.

 

Plasmids constructed in this study:

The following plasmids were constructed for this study:

pEJ5: Contains the gem-1 cDNA, beginning with the initiation codon and extending to the stop codon at the end of exon 10, inserted into pcDNA3.1 (Invitrogen).

pEJ7: pEJ5, with the GFP segment plus UTR from pPD95.67 (FIRE et al. 1990) (A. FIRE, personal communication) (but lacking the nuclear localization signal) replacing the stop codon of gem-1.

pEJ44: A gem-1:gfp translational fusion generated by inserting the following three segments into pPD95.67 to fuse gfp to the 3'-end of gem-1: (i) a 6.2-kb genomic BamHI fragment that includes the promoter, first exon, first intron, and beginning of the second exon of gem-1; (ii) a segment of gem-1 cDNA corresponding to the remaining portion of exon 2, exon 3, plus the first part of exon 4; and (iii) a genomic segment encompassing the rest of exon 4 through the end of the coding portion of exon 9.

pEJ52: Derived from pEJ44 by cutting with BamHI and HpaI and religating with an adapter segment created by annealing oligos o839 gatccttggaagcggccgc and o840 gcggccgcttccaag. This results in the removal of the entire gem-1-coding sequence and creates a unique NotI site at the junction between the first intron of gem-1 and gfp.

pJH8: Contains a 3-kb promoter fragment from pes-1 inserted upstream of the gem-1 cDNA in pEJ5.

Transgenics:

Transgenic lines were generated by micro-injection as described by MELLO and FIRE (1995), using the rol-6(su1006) plasmid pRF4 (100 µg/ml) as a transformation marker.

pEJ52 in vivo recombination mix:

We used in vivo recombination (KEMP et al. 2007) to generate a gem-1::gfp reporter that contained all of the introns for gem-1. Primers o932 ctgagcaaaggaaaaataaaacgaattttcagcgcctcgaaacgccgtcagagtccgaATGACGGCAAGACGTCGTCCAAGCATGCGA and o933 ACCATCTAATTCAACAAGAATTGGGACAACTCCAGTGAAAAGTTCTTCTCCTTTACTCATCGTTAACTCCGTCGGTTTTCCACTTTCA were used to amplify a segment of gem-1 beginning in the first intron and extending to the end of the eighth exon. The resulting PCR product has 25 bp of homology flanking the NotI site of pEJ52 at each end and lacks the coding sequence for the last 23 aa of GEM-1. This PCR product was purified and mixed with an approximately equal molar amount of pEJ52 that had been cleaved with NotI and heat inactivated. pRF4 was added to this mixture and the final concentration of the recombining gem-1 and pEJ52 molecules was 30 µg/ml.

pes-1 and ehn-3 promoter fusions:

The ehn-3 and pes-1 promoters were amplified by PCR using the following two sets of primer pairs: for ehn-3, o1348 CTTGCCGTCATGGATCCGAGCTCGGTACCAAGTTTGTAATTTGGAAGCTGGGAGGA ATA and o1349 AAATTAATACGACTCACTATAGGGAGACCC AAAAGAGGTCCCGCTCCAACAAC; for pes-1, o1350 CTTGC CGTCATGGATCCGAGCTCGGTACCAAGCTAAATGTATTAT TATGTAGTAGTAAAAGAAAAC and o1351 AAATTAATACGA CTCACTATAGGGAGACCCAAGCTGGTGGATCGGCAGTGAG.

Each of these promoter-containing fragments was previously validated for its ability to drive expression within Z1 and Z4 after in vivo recombination (KEMP et al. 2007). In each case, the resulting PCR products have 25 bp of homology flanking the HindIII site in pEJ7. For each promoter segment an injection mix was made containing (i) 50 µg/ml of pEJ7 cut with HindIII and heat inactivated, (ii) 100 µg/ml pRF4, and (iii) 50 µg/ml of the PCR fragment.

dxEx18:

The dxEx18 extrachromosomal array was generated by injection of animals of genotype gon-2(q388) with a mixture of plasmid pTG96 (sur-5::GFP; YOCHEM et al. 1998) (100 µg/ml), plus cosmids F59H11 and T01H8 (which overlap to contain the entire gon-2 gene) (10 µg/ml each) and selecting for fertile transgenic progeny.

Identification of suppressor alleles of gem-1:

We identified gem-1 during the course of screening for extragenic suppressors of the temperature-sensitive gon-2(q388) mutation, as described previously (CHURCH and LAMBIE 2003). Among 1.5 x 10⁶ mutagenized genomes, we identified 14 independent suppressors that were both sex linked and at least partially dominant. During the course of mapping other suppressors of gon-2, we isolated another dominant X-linked suppressor mutation (dx53), which was fortuitously present in one of our mapping stocks (CB164). Since the dominant character of these mutations precluded complementation analysis, we arbitrarily chose to work with a single allele, gem-1(dx66), for our initial mapping and cloning efforts.

Through standard linkage tests we determined that dx66 maps to the right arm of the X chromosome, near unc-84 (Figure 1). Through SNP mapping, we narrowed the location of gem-1 to an interval between unc-9 and a polymorphism at the far left end of cosmid F02C12 (MATERIALS AND METHODS).

Next, we used RNAi to test the candidacy of predicted genes within the vicinity of gem-1. Since there are no deficiencies for this region, we had no immediate clue as to whether the dominant character of the dx66 allele was due to a reduction (hypomorph or antimorph), increase (hypermorph), or alteration (neomorph) of gem-1 activity. Therefore, we performed RNAi in two different genetic backgrounds: gon-2(q388), which should be suppressed if dx66 is a hypomorphic or antimorphic mutation, and gon-2(q388); gem-1(dx66), which should exhibit abrogation of suppression if dx66 is a hypermorphic or neomorphic allele. We found that inactivation of one gene within this region, C49F8.2, did abrogate suppression of gon-2(q388) by dx66, thus suggesting that this gene corresponds to gem-1.

To further investigate the correspondence between C49F8.2 and gem-1, we sequenced the predicted coding region for each of the dominant X-linked suppressor mutations. In all 14 cases, we found a single nucleotide change within C49F8.2 (Figure 2), which we will subsequently refer to as gem-1. As discussed in more detail below, gem-1 encodes a multipass transmembrane protein.

View larger version (93K): In this window In a new window Download PPT slide   FIGURE 2.— Alignment of representative SLC16 family members. ClustalW (LARKIN et al. 2007) was used to align amino acid sequences and formatting was done using BOXSHADE. The nearest BLAST matches to GEM-1 are shown for the parasitic filarial nematode B. malayi (170588227), C. briggsae (157771688), Drosophila melanogaster (28573971), the flour beetle (Tribolium castaneum; 91088475), the honeybee (Apis mellifera; 110758321), humans (SLC16A14; 116283513), C. elegans (PES-22; 115533486), and the mosquito (Anopheles gambiae; 158301624). Predicted transmembrane domains (M1–M12) are based on comparison with other characterized family members (e.g., POOLE et al. 1996; MANOHARAN et al. 2006), but precise junctions are not known.

 

gem-1(0) enhances gon-2(q388):

Since our RNAi experiments suggested that the mutant alleles of gem-1 that we isolated as suppressors of gon-2(q388) are gain-of-function mutations, we were interested in determining the loss-of-function phenotype of gem-1. Therefore, we screened a deletion library and identified a putative null allele, gem-1(bc364). bc364 deletes 1109 bp with endpoints in exons 6 and 7 (Figure 1). This results in a shift in reading frame, so only the first 310 of 771 amino acids are correctly translated (followed by 36 novel amino acids and then a stop codon; Figure 3). Therefore, bc364 is highly likely to be a loss-of-function mutation and may be a null allele.

View larger version (46K): In this window In a new window Download PPT slide   FIGURE 3.— Predicted topology of GEM-1. The amino acid sequence of GEM-1 is shown, with locations of mutations indicated. The shaded region represents plasma membrane, with the extracellular face above. Overall topology is based on POOLE et al. (1996).

 
In an otherwise wild-type background, gem-1(bc364) homozygotes have no apparent mutant phenotype (data not shown). However, in a gon-2(q388) background, gem-1(bc364) nearly completely blocks gonad development at the restrictive temperature for gon-2(q388) (23.5°). This suggests that gem-1(+) probably either stimulates gon-2 activity or acts in parallel to offset the effects of gon-2(q388). These results also support the idea that the suppressor alleles of gem-1 are hypermorphic gain-of-function mutations.

gem-1(gf) suppresses gon-2(0):

If gem-1(+) acted by stimulating gon-2 activity, then the gem-1 gain-of-function (gf) alleles would be expected to increase this stimulation, thus increasing the amount of activity provided by gon-2(q388). In this case, the gem-1(gf) alleles would be unable to suppress a null allele of gon-2. Alternatively, if gem-1(+) acted in parallel to gon-2, the gem-1(gf) mutations might be able to suppress the complete inactivation of gon-2. To distinguish between these possibilities, we tested the ability of gem-1(dx66) to suppress gon-2(ok465), a deletion allele that was provided by the C. elegans Knockout Consortium (MOERMAN and BARSTEAD 2008). gon-2(ok465) deletes 507 bp of genomic sequence, including the region that encodes the sixth transmembrane-spanning segment of GON-2, and is therefore expected to lack channel activity. gon-2(ok465) homozygotes derived from a strain carrying an extrachromosomal array (dxEx18) that contains gon-2(+) are almost always vulvaless (93.1%, n = 248) . However, animals of genotype gon-2(ok465); gem-1(dx66) are fully suppressed (0% vulvaless, n > 1000). Therefore, gem-1(gf) mutations can bypass the requirement for gon-2 activity during the initiation of gonad development.

Suppression of gon-2(lf) by gem-4(lf) does not require gem-1 activity:

Previously, we found that loss-of-function mutations in the copine-encoding gene gem-4 are able to suppress gon-2(q388), but cannot suppress a complete loss of gon-2 function (CHURCH and LAMBIE 2003). One possible explanation for these results could be that inactivation of gem-4 causes a slight increase in gem-1 activity, but not enough to bypass the requirement for gon-2. If this were the case, then suppression of gon-2(q388) by gem-4(lf) would require gem-1 activity. To test this possibility, we constructed the gon-2(q388); gem-4(dx77); gem-1(bc364) triple mutant and determined the penetrance of the Vulvaless (Vul) phenotype. We found that gem-4(dx77) is still able to suppress gon-2(q388), even in a gem-1(0) background (Table 1). Therefore, gem-4(lf) does not suppress gon-2(lf) by negatively regulating gem-1.

View this table: In this window In a new window   TABLE 1 Phenotypic effects of gem-1(bc364)

 

gem-1 encodes a member of the SLC16 family of solute transporters:

The GEM-1/C49F8.2 protein product is one of seven members of the SLC16 monocarboxylate transporter family of proteins encoded within the C. elegans genome (WormBase; http://www.wormbase.org, release WS192, 7/25/2008). In C. elegans and other organisms, the overall amino acid identity between paralogous SLC16 family members tends to be rather low (30%) and is highest within the predicted transmembrane regions (HALESTRAP and MEREDITH 2004; LIU et al. 2008). A comparative alignment of proteins that give the highest BLAST scores when the NCBI protein database is queried with GEM-1 is shown in Figure 2. GEM-1 may be an outlier among the SLC16s, since apparent orthologs (based on reciprocal best BLAST scores) are present only in Brugia malayi and Caenorhabditis briggsae.

gem-1(gf) mutations occur at multiple locations within the protein-coding sequence:

Despite their relatively low overall level of amino acid identity, all SLC16 family members are likely to share the same topology: N-terminal and C-terminal cytoplasmic domains that flank two groups of six transmembrane domains that are separated by a variably sized cytoplasmic loop (Figures 2 and 3). The gem-1(gf) mutations occur at multiple locations within the protein-coding sequence (Figures 2 and 3). Seven occur within the predicted transmembrane helices, and these are distributed across 5 of the 12 transmembrane regions. The other seven mutations occur within the large cytoplasmic loop. Two of the mutational sites, dx92 and dx57/dx67, affect residues that are identical among all of the nematode and insect proteins, four alter residues that are identical in each of the three nematode proteins (dx75, dx69, dx91, and dx66), and seven are not conserved (dx76, dx72, dx79, dx70, dx68, dx71, and dx82).

Although it is clear that we have not saturated gem-1 for gain-of-function alleles, we do see evidence of mutational clusters. Three of the seven transmembrane alleles occur within segment 2, and two of these affect the same aspartate residue; one (dx57) converts this to valine and the other (dx67) converts it to asparagine. There are two apparent clusters within the cytoplasmic loop. The first is represented by dx72 R329Q and dx75 S332F and possibly also by dx79 H360Y. The second includes dx53/dx70 G482E, dx69 G483E, dx91 R484K, and possibly also dx68 M510I. Note that the dx53 mutation, which we isolated from strain CB164, has the same nucleotide change as the dx70 mutation that we obtained in our suppressor screen.

gem-1(gf) alleles have hypermorphic character:

During initial outcrosses, we determined that each suppressor allele of gem-1 is at least partially dominant; however, these assays were performed using stocks that had not been extensively backcrossed, so the variations in penetrance that we observed between the different alleles might have been due to incidental mutations in other loci that were retained after the initial mutagenesis. Therefore, we performed two to three additional backcrosses with six representative alleles and performed dosage analyses using these. We found that each allele exhibits reasonably efficient suppression of gon-2(q388) when homozygous (Table 2). However, suppression is significantly less efficient when the suppressor allele is placed over wild type and much less efficient when placed in trans to gem-1(0). We also performed crosses in which we used the attached duplication mnDp10 to vary the dosage of gem-1(+) (Table 2). From these results, it is clear that increasing the amount of gem-1(+) activity increases the efficiency of suppression of gon-2(q388). Overall, our data are again consistent with the idea that the suppressor alleles are hypermorphic gain-of-function mutations.

View this table: In this window In a new window   TABLE 2 Effects of gem-1 allele configuration on suppression of gon-2(lf)

 

gem-1(gf) alleles behave additively in trans-heterozygous combinations:

If GEM-1 functions as a multimer, we might observe nonadditive interactions between different classes of gain-of-function alleles; i.e., the efficiency of suppression in a trans-heterozygote might be less than either homozygote. However, if GEM-1 functions as a monomer, the different alleles would be most likely to behave additively. Therefore, we assayed the efficiency of suppression of gon-2(q388) among animals trans-heterozygous for representatives of each cytoplasmic cluster (dx70 and dx75), plus two different transmembrane mutations (dx57 and dx66). In each case, we observed highly efficient suppression (Table 3). While these data do not argue in favor of the idea that GEM-1 acts as a multimer, they also do not exclude this possibility.

View this table: In this window In a new window   TABLE 3 Phenotypes of gem-1 trans-heterozygotes in gon-2(lf) background

 

GEM-1::GFP is expressed within Z1 and Z4 and localizes to the plasma membrane:

To examine the expression and localization of GEM-1, we assembled reporter constructs lacking introns 2 and 3 (pEJ44) and with the full genomic gem-1 sequence (pEJ52 recombination mix, MATERIALS AND METHODS); in each of these, 6.3 kb of upstream sequence drives the expression of a gem-1::gfp translational fusion. In first-stage larvae, GEM-1::GFP is expressed on the plasma membrane of multiple cell types. These include the somatic gonad progenitors Z1 and Z4 (Figure 4), most or all of the cells in the pharynx, and multiple neurons in the head and tail (data not shown). Expression was observed in the body-wall muscles in the case of the pEJ52 mix, but not the pEJ44 mix. This difference is probably due to the absence of introns 2 and 3 in pEJ44. GEM-1::GFP expression persists within at least a subset of somatic gonad cells in later larval stages and is occasionally detectable within the distal tip cells in adult animals. Overall, the expression pattern that we have observed is in good agreement with that described for a 5.2-kb gem-1 promoter fragment placed in a transcriptional reporter construct (http://www.wormbase.org, release WS192, 7/25/2008).

View larger version (82K): In this window In a new window Download PPT slide   FIGURE 4.— Expression of gem-1::GFP in the L1 stage gonad. (Left) DIC and (right) GFP fluorescence imaging of an L1 stage animal that carries an extrachromosomal array with a gem-1::GFP translation fusion (pEJ44). Arrow (left) indicates the Z1 gonadal precursor cell. The arrowhead in the DIC image (left) indicates an adjacent germ cell. Other bright areas in the GFP channel are due to autofluorescence.

 

GEM-1::GFP rescues gem-1(0) and suppresses gon-2(lf):

GEM-1::GFP efficiently rescues the Gon phenotype of gon-2(q388); gem-1(bc364) animals at the restrictive temperature for gon-2(q388) (Table 4). Therefore, when present in multiple copies on an extrachromosomal array, GEM-1::GFP not only rescues gem-1(bc364), but also is capable of suppressing gon-2(q388). This is consistent with the idea that the suppressor alleles of gem-1 are hypermorphs.

View this table: In this window In a new window   TABLE 4 Transformation rescue of gon-2(q388); gem-1(bc364)

 

No apparent redundancy between gem-1 and other SLC16 family members:

Although the gem-1(0) mutation has no apparent phenotypic effects outside of the gonad, it could be that gem-1 is redundant to one of the other six C. elegans SLC16 family members in nongonadal tissues (the paralogs are T02G5.12, C10E2.6, K05B2.5, M03B6.2, C01B4.9, F59F5.1, Y19D10A.12). Therefore, we injected double-stranded RNAs corresponding to each of these genes into gem-1(0) hermaphrodites and inspected the F₁ progeny for novel phenotypes. However, the only case in which we detected an abnormal phenotype was C10E2.6, and we observed the same phenotype (slow growth) when we performed C10E2.6 RNAi in a gem-1(+) background. We obtained similar results using RNAi feeding clones from the Ahringer library (KAMATH et al. 2003). Although these are largely negative results, they do not support the idea that gem-1 performs an essential function that is also performed by one of the other SLC16 family members in C. elegans.

gem-1 expression within Z1 and Z4 can rescue the gem-1(0) mutant phenotype:

The simplest model for gem-1 function is that it acts directly within Z1 and Z4, the gonadal precursors. Therefore, we tested whether we could rescue gem-1(bc364) by driving expression of gem-1(+) in these cells with either of two promoters. In one experiment, we tested the promoter for ehn-3, which is expressed exclusively within Z1 and Z4 during mid-embryogenesis, but is then downregulated later in embryogenesis (MATHIES et al. 2004). In a separate pair of experiments, we tested the promoter for pes-1. This promoter has two phases of expression: First, it is transiently expressed within the D lineage and a subset of the AB lineage during early to mid-embryogenesis (HOPE 1994). Second, it is specifically expressed within Z1 and Z4 during embryogenesis after they have finished migrating and then remains in these cells until shortly before they divide in the L1. We previously assayed the promoter segments that were used in these experiments and verified that they were able to drive GFP expression in the predicted spatial and temporal pattern (MATERIALS AND METHODS; KEMP et al. 2007).

We found that expression of gem-1::GFP using either of these promoters could partially rescue the Vul phenotype of gon-2(q388); gem-1(bc364) animals (Table 4). Although the efficiency of rescue is not as high as in the lines generated using the endogenous gem-1 promoter (Table 4), it does equal or exceed that observed in gon-2(q388) single mutants (Table 1), thus indicating that the gem-1 activity level provided is at least the same as in gem-1(+) animals. In the case of the pes-1 promoter, we verified that expression of GEM-1::GFP was confined to Z1 and Z4 (plus one or two cells in the head region) in early L1 stage animals. Possibly due to limited perdurance of GEM-1 when expressed from these promoters, almost all of the non-Vul transgenic animals were sterile (the sterile phenotype was variable, depending on the extent of gonad development). Nevertheless, we can conclude that expression of gem-1 within Z1 and Z4 is sufficient to provide wild-type function for the initiation of gonadal cell divisions.

What is the normal function of gem-1?

We identified gem-1 on the basis of the ability of gain-of-function alleles to bypass the requirement for gon-2 activity during gonad development. The gain-of-function alleles of gem-1 exhibit no other obvious phenotypes. In fact, the standard CB164 strain carries a gem-1(gf) mutation (dx53), and presumably various stocks that investigators have derived from this strain also carry the dx53 mutation. Therefore, under standard growth conditions, increasing the activity level of gem-1 causes no apparent deleterious effects. Furthermore, the only effect of inactivation of gem-1 by RNAi or mutation that we observed was enhancement of gon-2(lf).

The C. elegans genome contains six other SLC16 family members that are moderately similar to gem-1 and could potentially have overlapping functions (http://www.wormbase.org, release WS192, 7/25/2008). We tested whether their inactivation in a gem-1(0) background would cause any synthetic phenotypes. However, none of the RNAi treatments resulted in any evident synthetic effects on growth rate, behavior, or fertility. Therefore, under the conditions that we have tested, gem-1 does not have any essential function. It does remain possible that gem-1 shares an essential function with more than one other SLC16 family member, and uncovering this would require more extensive tests of combinatorial gene inactivation.

SLC16 family proteins are present in all eukaryotes and are typically expressed on the plasma membrane (for reviews, see ENERSON and DREWES 2003; HALESTRAP and MEREDITH 2004; MORRIS and FELMLEE 2008). The most extensively characterized family members have been shown to mediate proton-coupled transport (both import and export) of lactate, pyruvate, and other monocarboxylates in mammalian cells. Other family members have been found to transport short chain fatty acids (HADJIAGAPIOU et al. 2000), aromatic amino acids (KIM et al. 2001), thyroid hormone (FRIESEMA et al. 2003), and various pharmacological agents, including -hydroxybutyrate (MORRIS et al. 2005). To date, the substrate specificity has thus far been determined for only 7 of the 14 mammalian SLC16 proteins (MORRIS and FELMLEE 2008). Genetic exploration of the functions of the various SLC16 family members is still in the early stages. However, two recent studies indicate important functions for SLC16s in human lens homeostasis (MCT12; KLOECKENER-GRUISSEM et al. 2008) and in the apoptosis of ectopic primordial germ cells in Drosophila (out; YAMADA et al. 2008).

The simplest model for GEM-1 function is that it acts directly as a cation transporter that can substitute for GON-2. Since supplementation of the medium with Mg²⁺, but not Ca²⁺, can suppress the enhancement of gon-2(lf) by gem-1(0) (E. LAMBIE, unpublished observations), it seems most likely that Mg²⁺ is the critical substrate. Possibly, the primary role of GEM-1 is to transport a negatively charged organic molecule, and Mg²⁺ is fortuitously cotransported, as in the case of the bacterial citrate transporter (BOORSMA et al. 1996). Alternatively, it could be that the function of GEM-1 is to promote the activity of a separate protein that acts as the actual cation transporter, e.g., by establishing a physiological precondition such as pH modulation or by facilitating localization of the transporter protein to the plasma membrane.

Although the gem-1(0) mutant has no evident phenotype, it remains possible that gem-1 performs an important function that is also carried out by one or more other genes. The ability of gem-1(+) to partially compensate for the absence of gon-2 either could be fortuitous or gem-1(+) activity could be advantageous under certain physiological or environmental conditions where GON-2 activity is inhibited, but GEM-1 activity is relatively unaffected.

How do the suppressor alleles alter gem-1 activity?

The gem-1(gf) alleles occur at many different locations within the protein-coding sequence and could conceivably alter different aspects of protein function. One possibility, particularly in the case of the cytoplasmic loop, is that a mutation could interfere with the ability of a negative regulatory protein, e.g., a kinase or ubiquitylation factor, to bind to GEM-1 (Figure 5A). A negative regulator of this type could act through various mechanisms, such as inhibition of conformational changes necessary for transport activity or targeting GEM-1 for degradation. Another possibility is that a mutation could shift the specificity of GEM-1, favoring the transport of substrate(s) that compensate for the loss of gon-2 activity (solid circles in Figure 5B). Mutations that alter substrate specificity of SLC16 family transporters (GARCIA et al. 1994) as well as of other transporters (e.g., SLUGOSKI et al. 2007) have been reported in the literature. Alternatively, a mutation could alter the conformational equilibrium of the transporter, thus increasing the efficiency of transport (LESTER et al. 1994) (Figure 5C). This could occur either by causing GEM-1 to favor an open, channel-like conformation or simply by increasing the overall rate of the translocation cycle. Such effects have been described for mutations induced in the human serotonin transporter (KRISTENSEN et al. 2004). Finally, if GEM-1 interacts with another transporter protein (either as a regulatory factor or as part of a heteromeric transporter), a mutation could potentially increase the efficiency of this interaction (Figure 5D).

View larger version (33K): In this window In a new window Download PPT slide   FIGURE 5.— Possible modes of action of gem-1(gf) mutations. (Left) The behavior of wild-type GEM-1 protein. (Right) The effects of GEM-1(gf). (A) Impaired ability of negative regulatory protein (stop sign) to bind to GEM-1. (B) Shift in substrate specificity. (C) Altered conformational equilibrium. (D) Enhanced interaction between GEM-1 and a separate transporter protein. Shaded bar, plasma membrane with extracellular face on top; small circles, transport substrates.

 

General implications for SLC16 family proteins:

Although GEM-1 does not have an obvious vertebrate ortholog based on amino acid alignments, the results of our work are potentially relevant to other organisms, including mammals. As discussed above, our findings suggest that SLC16 family proteins might be regulated by multiple post-translational mechanisms. Furthermore, since amino acid changes at many different sites within the GEM-1 protein-coding sequence are capable of elevating protein activity level, it may be that de novo mutations within human monocarboxylate transporters will also result in elevated activity level, rather than reduced function. Finally, since half of the mammalian SLC16 family members are presently orphans, it may be that one or more of these proteins performs a function comparable to that of GEM-1.

We thank Andy Fire for gifts of plasmids and reviewers for helpful comments on the manuscript. This work was supported by grants from the National Institutes of Health (NIH) to E.J.L. (GM49785) and B.C. (GM069950). Some nematode strains used in this work were provided by the Caenorhabditis Genetics Center, which is funded by the NIH National Center for Research Resources.

¹ Department of Biological Sciences, Marquette University, Milwaukee, WI 53201.

² Max-Planck-Institute of Immunobiology, Stübeweg 51, D-79108 Freiburg, Germany.

BOORSMA, A., M. E. VAN DER REST, J. S. LOLKEMA and W. N. KONINGS, 1996 Secondary transporters for citrate and the Mg(2+)-citrate complex in Bacillus subtilis are homologous proteins. J. Bacteriol. 178: 6216–6222.[Abstract/Free Full Text]

BRENNER, S., 1974 The genetics of Caenorhabditis elegans. Genetics 77: 71–94.[Abstract/Free Full Text]

CASADABAN, M. J., A. MARTINEZ-ARIAS, S. K. SHAPIRA and J. CHOU, 1983 Beta-galactosidase gene fusions for analyzing gene expression in Escherichia coli and yeast. Methods Enzymol. 100: 293–308.[Medline]

CHURCH, D. L., and E. J. LAMBIE, 2003 The promotion of gonadal cell divisions by the Caenorhabditis elegans TRPM cation channel GON-2 is antagonized by GEM-4 copine. Genetics 165: 563–574.[Abstract/Free Full Text]

ENERSON, B. E., and L. R. DREWES, 2003 Molecular features, regulation, and function of monocarboxylate transporters: implications for drug delivery. J. Pharm. Sci. 92: 1531–1544.[CrossRef][Medline]

FIRE, A., S. W. HARRISON and D. DIXON, 1990 A modular set of lacZ fusion vectors for studying gene expression in Caenorhabditis elegans. Gene 93: 189–198.[CrossRef][Medline]

FRASER, A. G., R. S. KAMATH, P. ZIPPERLEN, M. MARTINEZ-CAMPOS, M. SOHRMANN et al., 2000 Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408: 325–330.[CrossRef][Medline]

FRIESEMA, E. C., S. GANGULY, A. ABDALLA, J. E. MANNING FOX, A. P. HALESTRAP et al., 2003 Identification of monocarboxylate transporter 8 as a specific thyroid hormone transporter. J. Biol. Chem. 278: 40128–40135.[Abstract/Free Full Text]

GARCIA, C. K., J. L. GOLDSTEIN, R. K. PATHAK, R. G. ANDERSON and M. S. BROWN, 1994 Molecular characterization of a membrane transporter for lactate, pyruvate, and other monocarboxylates: implications for the Cori cycle. Cell 76: 865–873.[CrossRef][Medline]

GOYTAIN, A., and G. A. QUAMME, 2005a Functional characterization of ACDP2 (ancient conserved domain protein), a divalent metal transporter. Physiol. Genomics 22: 382–389.[Abstract/Free Full Text]

GOYTAIN, A., and G. A. QUAMME, 2005b Functional characterization of the human solute carrier, SLC41A2. Biochem. Biophys. Res. Commun. 330: 701–705.[CrossRef][Medline]

GOYTAIN, A., and G. A. QUAMME, 2005c Identification and characterization of a novel mammalian Mg2+ transporter with channel-like properties. BMC Genomics 6: 48.[CrossRef][Medline]

GOYTAIN, A., R. M. HINES, A. EL-HUSSEINI and G. A. QUAMME, 2007 NIPA1(SPG6), the basis for autosomal dominant form of hereditary spastic paraplegia, encodes a functional Mg2+ transporter. J. Biol. Chem. 282: 8060–8068.[Abstract/Free Full Text]

GOYTAIN, A., R. M. HINES and G. A. QUAMME, 2008a Functional characterization of NIPA2, a selective Mg2+ transporter. Am. J. Physiol. Cell Physiol. 295: C944–C953.[Abstract/Free Full Text]

GOYTAIN, A., R. M. HINES and G. A. QUAMME, 2008b Huntingtin-interacting proteins, HIP14 and HIP14L, mediate dual functions, palmitoyl acyltransferase, and Mg2+ transport. J. Biol. Chem. 283: 33365–33374.[Abstract/Free Full Text]

HADJIAGAPIOU, C., L. SCHMIDT, P. K. DUDEJA, T. J. LAYDEN and K. RAMASWAMY, 2000 Mechanism(s) of butyrate transport in Caco-2 cells: role of monocarboxylate transporter 1. Am. J. Physiol. Gastrointest. Liver Physiol. 279: G775–G780.[Abstract/Free Full Text]

HALESTRAP, A. P., and D. MEREDITH, 2004 The SLC16 gene family: from monocarboxylate transporters (MCTs) to aromatic amino acid transporters and beyond. Pflugers Arch. 447: 619–628.[CrossRef][Medline]

HODGKIN, J., 1997 Genetics, pp. 881–1047 in C. elegans II, edited by D. RIDDLE, T. BLUMENTHAL, B. MEYER and J. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

HOPE, I. A., 1994 PES-1 is expressed during early embryogenesis in Caenorhabditis elegans and has homology to the fork head family of transcription factors. Development 120: 505–514.[Abstract]

KAMATH, R. S., A. G. FRASER, Y. DONG, G. POULIN, R. DURBIN et al., 2003 Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421: 231–237.[CrossRef][Medline]

KEMP, B. J., J. HATZOLD, L. A. STERNICK, J. CORNMAN-HOMONOFF, J. M. WHITAKER et al., 2007 In vivo construction of recombinant molecules within the Caenorhabditis elegans germ line using short regions of terminal homology. Nucleic Acids Res. 35: e133.[Abstract/Free Full Text]

KIM, D. K., Y. KANAI, A. CHAIROUNGDUA, H. MATSUO, S. H. CHA et al., 2001 Expression cloning of a Na+-independent aromatic amino acid transporter with structural similarity to H+/monocarboxylate transporters. J. Biol. Chem. 276: 17221–17228.[Abstract/Free Full Text]

KLOECKENER-GRUISSEM, B., K. VANDEKERCKHOVE, G. NURNBERG, J. NEIDHARDT, C. ZEITZ et al., 2008 Mutation of solute carrier SLC16A12 associates with a syndrome combining juvenile cataract with microcornea and renal glucosuria. Am. J. Hum. Genet. 82: 772–779.[CrossRef][Medline]

KOLISEK, M., P. LAUNAY, A. BECK, G. SPONDER, N. SERAFINI et al., 2008 SLC41A1 is a novel mammalian Mg2+ carrier. J. Biol. Chem. 283: 16235–16247.[Abstract/Free Full Text]

KRISTENSEN, A. S., M. B. LARSEN, L. B. JOHNSEN and O. WIBORG, 2004 Mutational scanning of the human serotonin transporter reveals fast translocating serotonin transporter mutants. Eur. J. Neurosci. 19: 1513–1523.[CrossRef][Medline]

LARKIN, M. A., G. BLACKSHIELDS, N. P. BROWN, R. CHENNA, P. A. MCGETTIGAN et al., 2007 Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948.[Abstract/Free Full Text]

LESTER, H. A., S. MAGER, M. W. QUICK and J. L. COREY, 1994 Permeation properties of neurotransmitter transporters. Annu. Rev. Pharmacol. Toxicol. 34: 219–249.[CrossRef][Medline]

LIU, Q., S. DOU, G. WANG, Z. LI and Y. FENG, 2008 Evolution and functional divergence of monocarboxylate transporter genes in vertebrates. Gene 423: 14–22.[CrossRef][Medline]

MAGUIRE, M. E., 2006 Magnesium transporters: properties, regulation and structure. Front. Biosci. 11: 3149–3163.[Medline]

MANOHARAN, C., M. C. WILSON, R. B. SESSIONS and A. P. HALESTRAP, 2006 The role of charged residues in the transmembrane helices of monocarboxylate transporter 1 and its ancillary protein basigin in determining plasma membrane expression and catalytic activity. Mol. Membr. Biol. 23: 486–498.[CrossRef][Medline]

MATHIES, L. D., M. SCHVARZSTEIN, K. M. MORPHY, R. BLELLOCH, A. M. SPENCE et al., 2004 TRA-1/GLI controls development of somatic gonadal precursors in C. elegans. Development 131: 4333–4343.[Abstract/Free Full Text]

MELLO, C., and A. FIRE, 1995 DNA transformation. Methods Cell Biol. 48: 451–482.[Medline]

MOERMAN, D. G., and R. J. BARSTEAD, 2008 Towards a mutation in every gene in Caenorhabditis elegans. Brief. Funct. Genomic Proteomic 7: 195–204.[Abstract/Free Full Text]

MONTEILH-ZOLLER, M. K., M. C. HERMOSURA, M. J. NADLER, A. M. SCHARENBERG, R. PENNER et al., 2003 TRPM7 provides an ion channel mechanism for cellular entry of trace metal ions. J. Gen. Physiol. 121: 49–60.[CrossRef][Medline]

MORRIS, M. E., and M. A. FELMLEE, 2008 Overview of the proton-coupled MCT (SLC16A) family of transporters: characterization, function and role in the transport of the drug of abuse gamma-hydroxybutyric acid. AAPS J. 10: 311–321.[CrossRef][Medline]

MORRIS, M. E., K. HU and Q. WANG, 2005 Renal clearance of gamma-hydroxybutyric acid in rats: increasing renal elimination as a detoxification strategy. J. Pharmacol. Exp. Ther. 313: 1194–1202.[Abstract/Free Full Text]

NADLER, M. J., M. C. HERMOSURA, K. INABE, A. L. PERRAUD, Q. ZHU et al., 2001 LTRPC7 is a Mg.ATP-regulated divalent cation channel required for cell viability. Nature 411: 590–595.[CrossRef][Medline]

POOLE, R. C., C. E. SANSOM and A. P. HALESTRAP, 1996 Studies of the membrane topology of the rat erythrocyte H+/lactate cotransporter (MCT1). Biochem. J. 320(Pt. 3): 817–824.[Medline]

RUNNELS, L. W., L. YUE and D. E. CLAPHAM, 2001 TRP-PLIK, a bifunctional protein with kinase and ion channel activities. Science 291: 1043–1047.[Abstract/Free Full Text]

SAHNI, J., B. NELSON and A. M. SCHARENBERG, 2007 SLC41A2 encodes a plasma-membrane Mg2+ transporter. Biochem. J. 401: 505–513.[CrossRef][Medline]

SCHLINGMANN, K. P., S. WEBER, M. PETERS, L. NIEMANN NEJSUM, H. VITZTHUM et al., 2002 Hypomagnesemia with secondary hypocalcemia is caused by mutations in TRPM6, a new member of the TRPM gene family. Nat. Genet. 31: 166–170.[CrossRef][Medline]

SCHLINGMANN, K. P., S. WALDEGGER, M. KONRAD, V. CHUBANOV and T. GUDERMANN, 2007 TRPM6 and TRPM7: gatekeepers of human magnesium metabolism. Biochim. Biophys. Acta 1772: 813–821.[Medline]

SLUGOSKI, M. D., S. K. LOEWEN, A. M. NG, K. M. SMITH, S. Y. YAO et al., 2007 Specific mutations in transmembrane helix 8 of human concentrative Na+/nucleoside cotransporter hCNT1 affect permeant selectivity and cation coupling. Biochemistry 46: 1684–1693.[CrossRef][Medline]

SUN, A. Y., and E. J. LAMBIE, 1997 gon-2, a gene required for gonadogenesis in Caenorhabditis elegans. Genetics 147: 1077–1089.[Abstract]

TERAMOTO, T., E. J. LAMBIE and K. IWASAKI, 2005 Differential regulation of TRPM channels governs electrolyte homeostasis in the C. elegans intestine. Cell Metab. 1: 343–354.[CrossRef][Medline]

TIMMONS, L., D. L. COURT and A. FIRE, 2001 Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene 263: 103–112.[CrossRef][Medline]

WALDER, R. Y., D. LANDAU, P. MEYER, H. SHALEV, M. TSOLIA et al., 2002 Mutation of TRPM6 causes familial hypomagnesemia with secondary hypocalcemia. Nat. Genet. 31: 171–174.[CrossRef][Medline]

WICKS, S. R., R. T. YEH, W. R. GISH, R. H. WATERSTON and R. H. PLASTERK, 2001 Rapid gene mapping in Caenorhabditis elegans using a high density polymorphism map. Nat. Genet. 28: 160–164.[CrossRef][Medline]

WOLF, F. I., V. TRAPANI and A. CITTADINI, 2008 Magnesium and the control of cell proliferation: looking for a needle in a haystack. Magnes. Res. 21: 83–91.[Medline]

XING, J., X. YAN, A. ESTEVEZ and K. STRANGE, 2008 Highly Ca2+-selective TRPM channels regulate IP3-dependent oscillatory Ca2+ signaling in the C. elegans intestine. J. Gen. Physiol. 131: 245–255.[Abstract/Free Full Text]

YAMADA, Y., K. D. DAVIS and C. R. COFFMAN, 2008 Programmed cell death of primordial germ cells in Drosophila is regulated by p53 and the Outsiders monocarboxylate transporter. Development 135: 207–216.[Abstract/Free Full Text]

YOCHEM, J., T. GU and M. HAN, 1998 A new marker for mosaic analysis in Caenorhabditis elegans indicates a fusion between hyp6 and hyp7, two major components of the hypodermis. Genetics 149: 1323–1334.[Abstract/Free Full Text]

Communicating editor: D. I. GREENSTEIN

This article has been cited by other articles:

				D. E. Davis, H. C. Roh, K. Deshmukh, J. J. Bruinsma, D. L. Schneider, J. Guthrie, J. D. Robertson, and K. Kornfeld The Cation Diffusion Facilitator Gene cdf-2 Mediates Zinc Metabolism in Caenorhabditis elegans Genetics, August 1, 2009; 182(4): 1015 - 1033. [Abstract] [Full Text] [PDF]

International Access Link

Online ISSN: 1943-2361  Print ISSN: 0016-6731
Copyright 2009 by the Genetics Society of America
phone: 412-268-1812   fax: 412-268-1813   email: genetics-gsa{at}andrew.cmu.edu